GenePrediction:GLEAN_3444 Details

Name: GLEAN_3444
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:57388..59117 (+ strand)
Length: 1730
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:57388..58774 (+ strand)
Length: 1387
Type: CDS
Source: GLEAN
Position: GCSC_156:58828..59117 (+ strand)
Length: 290
>GLEAN_3444 class=GenePrediction position=GCSC_156:57388..59117 (+ strand)
ATGGGCTTCTCCTTCTTCAAGAACACGGCCGTGGTGTCGGACGACCCTTTTGGGCCGGCCGATGCCGACGACGAGGTGCG
CTCCGTCCATAGCTCTCATTACGGTATCGGCCGCGACGACGACGGACCGGCAGTGACGCGTACAGAGGACCGCGATCTGC
GGCGCGGGCTCGAGCAGCGCCATTTGTCGATGCTGGGCATCGCGGGCGCCATTGGCACGGGCCTCTTCCTAGGCCTGGGC
GCGTCCGTGCAGCAGGGCGGGCCGCTGGGCGCGCTGCTTGGCTACCTAACCGTCGGCGTGGCTGTTTGTGCGGTGCAGTT
TGCTCTCGGCGAGGTGGCCGCGCTCTTCCCTGTCACGGGCTCGTTTGTGCGCCATGCCGAGGTGCTAGTCGATCCGGCCC
TGGGTTTCGCCGTCGGCTGGAACATTGTGTACGGCAACCTGCTCTCAGTGCCGACTGAGATCACGGCCATCTGCGTGCTC
TTCGAATTCTGGACCGACATCAGCCCGGCTCTCTGGATCTGCATCTTCATCCTGGTGACCACGATTGTCGGCTTCTCGCT
GATTCGCGTCTTTGGCGAGATCGAGTTCTTCTTCTCCTTGCTCAAAATCGCCCTCGTCGTCTTCCTCATCATCCTCGGCC
TTGTCGTCGACCTCGGCGGCGTTCCCGGCACTCCACGCATCGGCTTCCGCTACTGGCGTTCGCCAGGCCCCTTTGTCGAG
TACATTGCTACCGGAACCTGGGGCCGCTTCCTCGGCTACTGGAGTGTCATGACCACAGCCGTCTTCTCCTTTGCCGGCGT
CGAGTCGCTAGCCATGGCCGCTGCCGAAACCCGCAACCCTCAGCGCGCCATCCCGCGTGCCTGCAAGAATGTCTTCGCCC
GCATCATCATCTTCTATGGCCTTGCCGTGCTTATTGTCGGCATGCTCGTTGCCAGCAATGACTCGCGCCTCAATGACGAC
TCTGGCACGGCAGCCCAGAGCCCCTTTGTCATCGCCGCCTCAGCCGCCGGCCTTCCTGCCGTTCCCTCCGTCGTCAATGC
CGTCGTCATTACGTCCGCTTGGTCCTCATCCAACCAAGCTCTGCTTTCCGGCACCCGTGTGCTCTACGGCCTCGCCCTTA
AGGGCCAGGCTCCCCGTGTTTTCCTGCGCACAAACTCTTGGGGCGTCCCATACGTCTGTGTCACCCTCTTCACCCTCTTC
ATGTTCCTCAGCTTCATGTCGCTCTCCAGCGGCGCCCTCAACGTCTTCTACTGGCTAGTCGATCTGACCTCCGCCGGTGT
CCTCGTCAGCTGGATCACTATCCTCTTCAACCACATCCGTCTGCGTCTGGCTTTGCGCAAACAAGGCATCTCAGCTAGCC
GGCTGCCGTGGTCAAATTCTTGGACCTGTATGTCCTGTCTTCCTCTGTGTCTGAAAGTCTTCAGCTACTAATAAGTCCAG
TGTACTCCTCTTATGTAGCGTTTGTCTTCAACATTATTGTCCTTCTGACCAATGGCTTCACCGTGTTCACAAAAGGAAAC
TGGGATGCCGCCTCGTTTGTCTCAGCTTACTTGGACATTCCACTTGTCTTATTAGCGTTTTCTATCTGGAAAATCCTCAA
AAAGACAAAGATGGTCTCTCTAGACGCGATACCGCTTCTCGAAGCACTAGATCAGTCCGACCAGTACCCAAACGAGCCGC
TTACCAAGAGAAAGGGAATAGTTCGTCTTGTCAGCTGGCTTTGGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62