GenePrediction:GLEAN_3446 Details

Name: GLEAN_3446
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:65817..68210 (+ strand)
Length: 2394
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:65817..65819 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_156:65886..66553 (+ strand)
Length: 668
Type: CDS
Source: GLEAN
Position: GCSC_156:66621..66783 (+ strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_156:66837..68210 (+ strand)
Length: 1374
>GLEAN_3446 class=GenePrediction position=GCSC_156:65817..68210 (+ strand)
ATGGTGAGTTGAATCTCTTCAACAAGCCACACCGCGTGACATACTAACAAAAATACAACCGCAACACAGACTTACAAGTT
ACGCCCTCGTGATCAGCCTGGAAGGCCACAGACGCCATCTTCAGAAGATGAAAGGTCATCATCCACTGGATCTGATTTCG
GTTCTTGGTCGGCGTTGAAGACTGTACTTCCCATTCGTCTAAGAGACAGCTCGTCGAGCGCTTCTCTGAATGTTTACCGC
TTGCCGTCCGATGATGGCATTCTGATCAAGGTGAAACCACCTGCATATCCGGGTAACATACCCTCAATCTCTAGCCAGAG
AGGGCTGGCAGGCCAGGGGCATGTCCCGTGCAGCATCGTCCTCGTCATCGATGTTTCTGGAAGCATGCAAGAAGATGCCC
CGGTCCCTGCAACAAAAGGCGAGCCCATGGAGAGCAATGGCCTGACAGTACTCGACCTGGTGAAGCATGCGGCGCGCACA
ATTCTTGAGACGCTGAACGAGCACGACTGCCTCGGAATTGTGACTTTTTCAGAGGATGCCAATGTGCTATTAATGCTCAC
TCCGATGACACAAGTAAACAAAGCGAAAGCGCTTCAGGTAATTCTAGATTTAGAGCCTTTGACGGTTACGAATCTGTGGA
AGGGCCTTACGGCCGGCATCGAGATCTTCTCGTCCAAAGCTCAGTTCAGCTCCGTACCCTCCATAATGCTGCTCACGGAC
GGTCTTCCAAATTTCATGTAAGTGACAGCGCTGGATTTTGGGGGATCTCATGAATGTCTCTCTGGAAATAACCGACATGC
CCAGGCACCCACCACAGGGCTACATACCAAAGCTGCGGACCTTTGGAAAGCTCCCGGCTCCAATTCACACATTCGGCTTT
GGTTACAACTTGCGCTCTGGCTTACTCAAATCCATATCTGAGCTCACCGGTGGCAACTACGCATTCATCTCCGATGCTGG
AATGCTTGTGAGTCTTTCCATACTTGAGCAGTCTTTCTATGTGTTGCTGATTCGCTACAGGGAACCGTTTTCATTCATGC
AGTTGCAAACATGCAATCCACTTTCGCTATGAACGCGACGCTGTGCGTTGAATTTCCTGCCTCGATGCATCTCGAGAAGG
CCATGGGCACTGTGGTCGGCGGGACGCAGCCGGTCGACCCGGTGAACGGACAGCAGCTCACGATACCCCTGGGTAGCATC
CAGTATGGGCAAACCCGCGATGTGTACCTGAGATGCACCCACAACGCGGAGTTGGAGTCTGGACTTGAACCGCGCACTGC
CCCCATCGTGAGGGTTAAGCTGGACTACGACCAGATGGAGCCGAGCACTTACTTCCACGCTACAACTCAGTGTGCTATGA
ATTTTGAAGACTCGTCAACAGCTCACGGCGCAGATGCACTGTCTGCGGATGAAGTTGCGTTCCACATCGCTCGATCTGAT
TTGTGCGCCACCATTTCGAGCTTATTTCCACTGCTCGACGAGGAAGAGCATGTGGCTGTAAATCATGAAGACGGCTTGAT
CTCCATTGCCATTTCAGCCTGGGAGAAAGTCACGTCGGCAAACGTATCTATCGGAAGCACTGCTTATAAAGCTTTGATGA
GAGACATCAGTGGCCAGGCATTGATGGCCATTCGAAACAAAGAAGATTACTCAATATGGGGACGGCATTATTTGCCCAGC
TTGCAGTCTGCACACATGTCGCAGCAGTGCAACTCGTTCAAGGATGCAGGTCCGCTTCTGTACGGCGCTTCGAGCACTCT
TTTCATCCAGTGCCGTGACAACCTGGATAAGGCATTTGACAGCTTGCCAGCACCGAAGCCGAGCGGCATTTCGGTGTCGA
ACGCACCCATCGGGATGAGCATGTACCGCAACCCGAATGGTGCCTGTTTCGCCAGCTTCTGTCGAGTGACTCTGACGGAC
GGGCGACATGTCCGGGTAAATCGTCTGAGACGCGGGATGCGAGTTCTGACGCCGCGAGGTCCGCGCACAGTTGCCGCTGT
GCTGAAGACCCCAGTTGTCGGTGCGCCGATGATGTTTGTGGGCAGCCTGCTAGTCACTCCGTGGCATCCGATTTCACACA
ACAGCAAAGACTGGGTCTTTCCGTGCCAGGCCGACAACCCACGCAAGAGGCCACGGGTCCGCTATACAGGATCTATCTAT
TCGGTGCTGCTGCAGCCAGATGGGGATGTGGATTCGCACGCACTTCGCATCGAAGGCATCTGGGTCGTGACTCTTGGTCA
CGGGCTGACGGAAAATGCAAATGGTACCGCAGCAGATGTGCGGGTGCACAGCGTGTTTGGAAGCTACGCTGGCGTGTGCC
AGGCTCTAGCCTCGCTGGATGTGCGTGAGGATGGCCTGGTGGTAAACAATCTCTCGTCGCGGGGCACTTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62