GenePrediction:GLEAN_3449 Details

Name: GLEAN_3449
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:74214..74859 (+ strand)
Length: 646
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:74214..74372 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_156:74433..74632 (+ strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_156:74741..74763 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_156:74834..74859 (+ strand)
Length: 26
>GLEAN_3449 class=GenePrediction position=GCSC_156:74214..74859 (+ strand)
ATGCCGTTCTGGACGTCGTTCGAGCCGGCCACGCCGCCCCGATACCGCGGTGCCTGTCTCTGCGGCAGCATCTCGTACGT
ACTGACGCAACGGCCGCGGCGGGTAGTGCAGTGCCACTGCACGCACTGTCAGGCCGATGGAGGGGGCCCGTTCCAGATTG
TGGGTTGTCGGTCGCCTGACGTGCGTCTTGTCTGTGCCTGGATCTTGCTGACCGTCCAGATGGCCGAATACCGCATCGAC
GAGGTTGTCGTCAAGGATCCGTGGAGCTACTGGAAGATCTACACGGTGCGCGAAGGCACGCTGAGCGGCCAGCCCAAGGA
GAAGCACTTTTGCGGCAACTGCGGCTGCACGCTGTGGACGGTGGCCATGCGCGATCGCGGCGAGCTGCGCATGGTTCGCA
CGAGCCTTATTGAGAACGGGTGGGTGGCGGGAGAGAGACAGAAAGAGACAAAGACAGGAATGGACAGCAGCTGACCAAAG
CCAGGCTGCAGCTGTTTCCGCCGACCGAAGTGCAATTTCGGCGCTAGGGACCGGCAGATGGGCGGAATGCGTACGTGAGA
ACGGTCGAAGATCCAAGCAGACACACATAGAACAAACATGGCTGCTCTGCCAGGCCTCAGGCGCTGACTCAGAGGGCGCC
ATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62