GenePrediction:GLEAN_3451 Details

Name: GLEAN_3451
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:81340..82398 (+ strand)
Length: 1059
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:81340..82398 (+ strand)
Length: 1059
>GLEAN_3451 class=GenePrediction position=GCSC_156:81340..82398 (+ strand)
ATGTCGAACCACAACGAGTTGAACAACAACACGGCCAAGAGGCAGAAATTTGAAAAGTTCATAAGGACAGGATGGAGTAT
TTCCAAACCAGAGATTCAATACATCCACGTGCACGAATGCATTGTACACATCTTGGGCGACTTTGAAGCCCACCATATAA
ATGAAAAGGTCTGGGCTGAGACCGACAACGGCCTGATCGCCAAGTATCAATGGGACTCCCACTGCTCCAAGACCCAGACA
GCTCATGATAGGTTTTTAATCGCGACCTACTTTGGCGGGCTCGCGTCGATGAACAATCTGGGTGACCGCATAATGAAGGA
AAGGATCCTAGACGCGGACAACTTCGAGTCCATTGAACAACTTCCCACCGTGCCCTTCATCGCCTTCACGCCCGTCGATT
GGAGGCACAGCAAGGGCAACTGGATACGGCCTGTTGTCGCTTGGGAGGACGAGCCGGCGGTCGACGCGGTAGGACTAGAC
AACATCGCGATCGAGCTTGGCCCCGACTGTCCTTCCGCCTTCTATGACCCGCAGATGTGGTACCGCCTCAAGCGAATCCG
TGACCAGCTTGAGTCCTGCAGCTTCTGGGACCACATCGACTACTCCGACAGAATGCTTCACACGAATCTTCGCTACAACG
GCCTCGCCATCCGCATGCTCTGGTACCTGATCGCTCACCTCTTTGATCTCCAGGACAGTGAAAATTTTACCGAAGACATG
ATCATGGACATGGCTGAGGAAGTTGCCAACGGTCTGCAGGATGATCTCAATTACGCCATCGACGACACCCGCGGCCCTAG
CTTCAAGGTCCCTACCGACAACGGTGAGCTTATCAAGCATATCGACCGCATCCGCAAAGCTGTCCTCGAACAGCAAGACG
TATACCGCTGGCGGCGCAACGGCCTCGGCACACTTGCCACCGCTTTCGCCCTGAGTATCAATCGTCCAGGCCCCCCTGTT
ATCGACGTGCCAAGAGAGGAGCCTCACAGCGCTGGTTTTGGACAGCCTGGTGCCAGCCACAGCGTCAAAGAAGTGGCCGG
GGACTACATGGTCGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62