GenePrediction:GLEAN_3452 Details

Name: GLEAN_3452
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:95835..98075 (+ strand)
Length: 2241
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:95835..95970 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_156:96075..96223 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_156:96288..96412 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_156:96571..96763 (+ strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_156:96903..97013 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_156:97085..97178 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_156:97246..97348 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_156:97411..97494 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_156:97572..97737 (+ strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_156:97849..98001 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_156:98058..98075 (+ strand)
Length: 18
>GLEAN_3452 class=GenePrediction position=GCSC_156:95835..98075 (+ strand)
ATGGTTGCCGCACCAGATATTGCAACTGCTGCGATTGGCGCAACCCTAATAAACGACGATGCTAGCAAGGAGAAGTCCAC
GGATCTTGAGAAGAGCGACGACAGCAGCGTAGCCGTGGCAGAGGTGCAGGACAATGGTAGGTAACCTGCCTGGTTCTTTG
TACTCCTCTTCGTTTTGTTCGTTTGCCTCTTCATCCAATTTTTTTTGTCCATTGAGATGTTCATGCTGATACTGCTTTAG
AGGTCGTTTCCGATTATCCACAGGAGGACTACAAGAGGCTGAAGCGGAAGATTGACAAGTATCTCCTCCCACTGATGTGG
CTATGCTATGGCATCCAGCAGACAGACAAGACGTCGCTAGGGACACAGGCCACATTTGGCCTTCGGGCGGTAAGTAGCTG
TGCAATCCTGGCAATCAGCTGTCTGTCACAGCTACTGACAGCGAGTCTCACAGGACACACACCTCAAGGGCCAGCAGTAC
TCGTGGCTAACAACGGCGTTTTACCTCACATACATGTGCTTTGAGTTTCCCTCCAACATACTGCTGCAGCGCTACATGAT
CGGCCGCACGCTGTCCGTGTATATGATATGTTGGGGTGTCATCGTCCTTTGCATAGGCTTTTGCAAGAACTTCACTCAGC
TGGTCACGCTGCGTGCCTTGCAGGGCGTATTCGAGGCAAGCCATCCTCGGCCGTTCTTGGTCTTTCTTGTGCGCCGTGCA
TTGCGCTGACAGACAGTCAGTGCTGCATCAGCCCGGGCTTCATCCTCGTAATTGGCTCCTGGTACACGACACGTGAGCAT
GCGTCGCGCTCGCTCGTCTTCCAGAGCGTCAATGCCGGGTTCGGTATCATTGCTAGCCTGATTCTGTACGGCATCGGCTC
GGTGCAGTACCATCGGCCTGACTTTGAGGCGTGGCGGTATATGTCTTATGTACGTGCCCGCCCTGCTCTGATATCCGAAG
CATGTCTGACCAGAGTGCAAATTTCTCGGATCTTTGACAATTCTCGTCGGTACTCTCTGCCTCTTCGTCTTGGGAACGCC
TTCTGAGGTGCGCTGACTGTCACCAGAGGAGAAAAAGATGGCCAATGTGCGCATCCGGAGCAACAACACGGACAATGACA
AGACGGGGATCAAGAAATGGAGTTGGGAGCAAGTGCGCGAGTGCTTGCTAGACCCCTGCGTAAGTGCTCTTCCCATCCAT
GACAGGGATGCGGCTGCTGGATGTCTTTTAACAATTGATGCTTGAGCCAGTTCTGGTTTTCTGGCATCAATGCCTTTCTC
AGTTCCGTTCCCAATGGCGGGCTGACAACATTTGGCGGTATCATCACGACCTCATTCGGCTTTAGTACGTTATTTACTTC
GGTTTAGCTTTCTCTTCCGTGCACGTGCTTCGTCTTTCTAACGTCCAGCAGCCAACCTTCAGGTCATTCTTCTCGATATC
CCTCGCAGCGTGTTTAGCGTTTGTTACTTTATTGTCATCGGCCTCGCTACGAGCCGGTGGAAGGACCTGCGCATGTAAGT
AAAGGACAAGCGAGTCTCATTCTGCCTGGTTGGATGTACCTAACTATACACCCAAGGTACTTTATGGCGTTTTCCGTCAT
CCCTCCTTTTGTCGGCTTCCTCGTGATGTCTCAGCTGCCCGACGAGAAGAGTTACAGATGGTCTAGATGGGGCGGGTAAG
GCTGCATCCTCCGTCGTTCAGTTGTATCGTAACGTAACTGACAGATCATTTGTGAAGCTACTTCATGTCGGTCCCTTTTG
TGATCGCCCTGTTTCTGTCCTGGACCCTCATTTCGTCCAACGTGGCCGGCCGGACCAAGCGCACTCTGACCTCGTCCTTC
ACCTTCGTCGGCTACTGCGTCGGCAACATGGTTGGTTCGCAGATCTTCAAGTCATCTGATGCTGTATGTTGCACGATTAA
CCCGCCATGTAATTACCCGTACGACTCTTGCTGACTTCTGAAGCCCGCATATACCCCAGGGATTATCGGATGCACGGTCT
GCTTCGGGCTTCAGTTTCTCCTCATTGTCACCTGGAGAATTGTGCTTGTGATGCGCAATCGACGCCGGGATAAGAATATA
CTGGAGCTGGGAATATCGGCAGAGGAGAGAATCGAGCGTGGCAAAGTGCTCGGCGAGCAGGACATTACCGACTTCAAGAG
CCCCTTCGTGAGTGATCCCGGTACCCAGACCGCACGAAGATACGATTGCTCACAACCTTTCAGTTTCGCTACACGCTGTA
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62