GenePrediction:GLEAN_3453 Details

Name: GLEAN_3453
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:101818..103459 (+ strand)
Length: 1642
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:101818..102041 (+ strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_156:102112..103459 (+ strand)
Length: 1348
>GLEAN_3453 class=GenePrediction position=GCSC_156:101818..103459 (+ strand)
ATGGGCGCGAACCAGTCCAAGCCGTCGACCGAGAGCGCCTTGAGTGAGAAGATGTCGATCGAGTACCAGTGCACGATGGA
GTCCAGCAGCCAGGACGAAGGCCGCGAGGCCGGTTATGTGTTTGTGGACCACCGGACCAGCGGCAGCACGCGCAAGGCCG
AAGGGCTGTCACTGTCGCAGGTGTCGGGCTGGCAGAGCGAGGTGCTGGCGAGTGCAAAGAACCGGTGTGTATGAGACGAT
GCCGGTAGCTGGTGATGGAGCGATGAGACGAATGGCTGACCGTCCTGTTGGCAGACTCGCACTGACGGCACTGAGCGCGG
CCGAGCCGAAAAAGGTGCTGCTGACACGCGAGGCCGCCATGGCGGACCAGCACGTCTTCAGCCTGCAGATCCCGTTCGAG
GGCGGCCCGGTGACGAATCAGGGCAGCAGCGGGCGGTGCTGGCTGTTCGCGGCGACCAACGTGTTCCGGGTGGCGCTGAT
GCAAAAGTACGAGCTCGCCGGCTTCGAGCTCTCGCAGGCGTACCTCTTCTTCTGGGACAAGTTGGAGAAGAGCAACTGGT
TCCTGGAGCAGGTGCTCGACACGGCGACGCTCGACCTCGACGGTCGCGTGGTCCAGACCCTGCTGGCCGCGCCCGTGTCA
GACGGTGGCCAGTGGGACATGGTGCGCAACCTGGTAGCCAAGTACGGAATCGTGCCGCAAGCCCTGTATCCCGACAGCTT
CAGCGCGGCCGCGTCTCAGACGCTTAACCAGGTCGTGGCTACGCGGCTGCGGGCAGGCGCGCTGGAGCTGCGGCAGCTAG
CACGTGACTCGCAGATATCTTTGTCAGCATATTCGTCTGCCTCACCATCGGCATCATCAGCCCTCGCCGCGGCCAAGGAC
CGGATCCTGCGCGACATCCACACGGTACTGACGCTGACGCTGGGCCCGCCGCCGGCGGCCACGGCCGAGTTTACGTGGTC
GTTTGTGGACCGGCGAGGAAGGGCGCGTCGCGTGCGCGCGTCGCCGCTCGCGTTTGCCGCCGACATCTACAGCAGCTCGA
CGGGGCCGCTGCGCATCTCCTCGGCGGCGATCGACCGCATGGTGTCGCTCGTGCACGACCCGCGCCACCCGCCGCTGTCG
CTGCTGACGGTCGACCGGCTCGGCAACGTGGTCGGACCTGGGGCCCGTGGCATCACGTACGTCAACGTCTCCATGTCGAC
CCTCAAGGCTGGCTGCATCGCGATGCTGCGCGCTGGGCTGCCCGTCTTCTTTGGCTGTGACGTCGGCAAGTTCAGCGACC
GCGATGCTGGCCTCCTCGACCTCGCCCTCTACGACTACCAGCTCGGGCTCGGGCTCGACCTCCTCGCCGCCGACAAGGCC
GCACGGCTCCGGTCCGGTGAGAGCGCCATGACCCATGCCATGGTCCTCACGGCCGTCCACATCGACCCTGAAAGTCATCA
GCCGGTCCGGTGGCGCGTCCAGAACAGCTGGGGCGAGGCCCCCGGCGCCCGCGGCTGGTTTCTTATGACCGACGCTTGGA
TGGACGAGTTCGTCTACCAGGCCGTCGTCGATCCTCGCTTCCTTCCTCGCGACGTCACCGACGTCCTCAAGAAGGATCCG
ATCGTGCTGCCGCTGTGGGACCCCATGGGTGCTTTGGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62