GenePrediction:GLEAN_3454 Details

Name: GLEAN_3454
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:108978..109647 (+ strand)
Length: 670
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:108978..109007 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_156:109049..109158 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_156:109221..109342 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_156:109403..109647 (+ strand)
Length: 245
>GLEAN_3454 class=GenePrediction position=GCSC_156:108978..109647 (+ strand)
ATGTCAGACGCTCTGAAGCAGAAACGCCGGGTCCGTTGAGACGGTGGACCTAGACGAGGTCAGCCGGACAGGCATCCCGG
CTGGTGGCCGCATTTGGAGCGTCATTAAATGGCCTCGGCGTCGGTAGGTCGCAAAGCCCAGACCTCGTCAACGCGACCAA
CTCTCTGCTGTACACCTTCATGTCGGTGGCATGCTTCCTGGGGCTTTGGCCGACCAACTGGATCGGCTTCCACCACGCGT
TAGCCTTTGGCCGGTCGGCAATCCGCTCTATGTGGCCGGGCTGTGCGACAACAACGGCTCCAGCATCACCAGGTCCGCCG
CGATGACGGCACCTGCTACACCGACCGCGCGATATCCCCTGGCGCGTCGAGCTGGCTGCCATGCGCCGCCTTTCCCTTAG
TTGCTCCATCCTGCTGCTCGTCCAGGTCGACTTCCGCCACCTACCGCTCTATCATCGACTGGGCCGGCCCGCGCAAAGTT
TTTCCGCGGTTTCAGCGTCTACCTCTTTGAGCGCATCAGCGCCGGTCTCGTCGAAAGGTACATCGGCAACCTGTTCGACT
ACTACGCCACCTTGCAGGTCGTGCGCAAGCGCAGGCTTAACGAGATCGAAGAGCAGATATTTCACGTCAGGGGGGCCGCT
GCCGATAAAGACCGCCATATAGACTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62