GenePrediction:GLEAN_3455 Details

Name: GLEAN_3455
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:110484..112994 (+ strand)
Length: 2511
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:110484..110694 (+ strand)
Length: 211
Type: CDS
Source: GLEAN
Position: GCSC_156:110763..110894 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_156:110958..111077 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_156:111138..111200 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_156:111331..112994 (+ strand)
Length: 1664
>GLEAN_3455 class=GenePrediction position=GCSC_156:110484..112994 (+ strand)
ATGACGCCGGCCGACATCAGGCTGCTCTTCAGCACAGCTGGAGAGACCGTTCTAGATCAAGGAAGCGGCAGATATGTCCT
CACAGAGACCGAGAAAACTCGGCGCATTAGTAGCCTTCAACAGGCCCTCGCTTCTGTCCAGCATCTCTGGCTGTCTGGGT
CAACAGACCTCGACACAGCTGTCGAAATTCTTGCCGACGGCAGTAGAGACGGTAAGAACCCAACGGGCGGTCTGGCACCC
CTGCACCCAATGTTTGGTCCTCTGCTAACCAACCTGCAGCGACATGGCGGAAACCGATTGGCGAGTCTGGCATACTCGCC
TTCTTCCTGGGCATCATTTGTGAAGCTGGCCTGCGCACCTCTCTGAAAATGCACACACTCCGCCTCATTGGCAATTCGTG
CGCCGACGAAGGTTGATTCACCTGCTTTGGTTGCATTGCCAGCTTGCGGCTGTCGTAGCTAACTCTTCATATAGACAGCA
ACCGAGCCCGCGTTGTTGCCGGAAATCACCTGCATCAACTCGTCCCGCTCCTATTTGACGATACTCTCTTGGCCTTCGCC
ATTCCCGTCATGTTCAACATCTGTGTCGACTACGGTATGTCCTCTCTACGGTTCGTCTTTTAGAACGCAGGTGCACTAAC
TAAGCTTCATCCAGAACCTGCTCAAGTCCAAGCCAGTCAGGCCGGCATCAGTCATGCCCTGCTGGATATCCTGTCCGGTC
CGCGCCTGTTGCAATGCAGAGCCTTTTTGTCCATGTGCTGCAAGATTCTTGGCCTGCTTGTCAAAAAGGGTCCGATCTAA
TCCTGCCTTCTTACAGCATACCTTATGCTAACGCAATTGTATGGCAGAACCTGACGCTCCCTTGGTCGACATTGACACCC
CAGTACGCCTTCTGCAGCTGGAAGCTAGCCCAGACGTCATTTTGGATGCCGAGGAATTTCAAACCCTAATTTCCATCGTC
CTTGCCTGTCTTTCGCATGAGACCTTCCAGGCAGAGCTCAACCGACGGGGGGGTGTTGAGTTACTGCTGAAAGCCTTTTC
CGACTCATACATCAAGTTTAGCGAAGCAGATCTCAACGCTGAAGATGCGGAAGATTTTGTCTTAGTTCGAAACCAGTTCA
CGGCCATCATTGCTGACGTTATGGCCGACTCGTCCTTTTTCACCGTCTATTCCGTGGCCTCGCCCGTTATACAGACCCTG
GAGCATTGGCTGCGCGATGATTCTACCAACACGGCCTTGAGGACTGCTGCGTGCTACGCGCTCGGCAACTTGGCCCGTTC
CGATGATACCAGTACCTATTTCGTCCACACAGACGAGGTACACACCAGCCTAATCTCGCTCCTCACCACGCAGTCCACAT
CAAGCAATCAGCCCCCCCCAACCCAGCTCTACTATGCCGCTCTCTCGTGTCTCAAAAACCTCGCCATTCCGCTTTCAAAC
AAGCCGAAATTGGGCATCATGCTCGAGCCAACCGTGAGCCTCCTTCCTCGCTTCTGGGCGAACTCCACGCAGCCACACCT
TCAGTTTGCCGCCATTTCTTTGACCCGGCTACTCCTCGCATCATGTCCCGACAACGTCAGACGCATATGTATCCCGTTAT
CGACGGACCCGTCTTCACCAGCTCATGAGCGAAGCAATCTCCACGTACTAGCCGACATCTTCAATCGCATCGATGCTGAG
AACGCAAAAACAGAAGCTGCGCGGGTCATAGCCACTGTTTGTCGTGTATTACACGCCACTCCGGGACAGCCTCCAGTTCT
GTCTGACGATTGGGAACCCAGCATTGAAGCAGGTACCACCGTTGCTGCCTCTTTTTCTATGCCATCTCTGACTACAGCGG
GCGCTGCTACTCTGATAGAGCCGGATTTGTCCTTGGTACCTGCAACAGCTACGCCATCACATCTCGAACAGTCTCGGCGA
GCACGTTTCTACGCTGCCCAGCTGGACATGGCCGATGCCCTGTCCTACTTGATGACCCAGAGTCGGTATCCTGTCTTGCG
GTCGGAGACCATCTTCATCTGCGCACTCATGAGCTGCTCTACAGACGGAGCCCGTCTCGTCATGCGCGCCCTCCAGCCGT
TCGATGTATGCAGGGTCCTTGTAGAAGCTGTGTCTGGCAAAGACATGGTGGACGGTCATGAACTTCAGATGGGCCAGAAG
CCTGCAGGGCAAGCTTCTGATAGCGGCGCCACCGTACCGTCAGAAACGTTGCTATTGCAAGAACTGTTGTCTTCTACCGA
AGGCACCAATGATGCATCCCTCATTCCGCTCCCAACTGCAGCAGAACATGGCTCTGAAAGCGGTGGGCCCACGCCTCAGC
CGGTCAACCCGGCACAAGCAGCACAAGCATCCCGCCTAGACCTCGAGAATGGCATCGTCTTGCTGTCCGAGATCATGAAG
AACTTCTCCCAGTTTCTGCCTCCTCCCCGTCGCAGCATGTTTGAGCAAACGTTGCAAATTGGGGCCACACGTCTTTCCCA
GGCCAAGGAGGAGCAGGCAAAGATCCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62