GenePrediction:GLEAN_3456 Details

Name: GLEAN_3456
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:118391..119411 (+ strand)
Length: 1021
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:118391..118733 (+ strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_156:118798..119411 (+ strand)
Length: 614
>GLEAN_3456 class=GenePrediction position=GCSC_156:118391..119411 (+ strand)
ATGCCCTTCACGGTACCGCTTCGCAGCGCAGCTGACGCTACGCGCTTTACGTCCACAGTGCCGCATGCGTCCCGGCGCGC
TGCTGGGCCCGGGTCTTCGGCTACCCCGGCGGCCTCTCGGTTCCAGTCGCCGGGCAGCAATGGCGGTGCACCGGGCGGCG
CAAGGCCACCGCCTCCGTCCTTCCCCGGCGAGACGCCAGAGCAGAAAGTAGCCCGGTTGCGTGCCGCACACATGGCGGCA
AAGAACGCCCAGGTGTCGCGCTTCGACCGCATTGTGCACTCGGCGCGGCACATGTTTGACTCGGCGCATAGAATCACCAT
TGTCGGCCTGATTGGGTTTACTGGTAAGCTTTGCCTTTTCCTTCTTTCTCTGGCTACCTTCATCTTAGCTTCTCGCTAAC
CCCATAGCCATTGCCGGACTCCTGACTGTCTACACCACCGTCGACATGATGCGCTTCAACCACAAGCGCAAGCTGGAGTT
TATCGCCGCCCAGAAGCAGATGGAAGACGACAGCCTTGCGGCAGCGCGACTGGCGTACATGCGAGGCGATGCGACAGAGG
AGCAGACGGCCTTGGTCGAGGAGGTGGCTGCGGCCGAGAGGGCGGCCATCAACGCCGGCGCACCGCCACCGGCACGGTCG
GGAGATGGCTTTTTCAAGATGCCGAGCTTGCTGGGCGCCCCATCGCCAGTGGCCGCCGAAAGCGCGCCGACTGCCGCCGC
CCCTGCAACTCCATCCTCTTGGGCCAAGTCCATGCTCTCCCGCGAGGAGCAGGGCGAGATCCCGGGCTCATCGCAGAGCC
GGCTCGGCTACGAGAGCCTGTCGGAAGAGGACGACTGGCCGGGTGCGCGTGAGAGCGACGTCGTGCGCGCTGTCGAGGAA
CACTCGGCATATCTGGCTGGCAAGGCTCAGGCAGCGCTCGACCGCGAGCGGGCCAACCAGCGCAACGGTGGCCCGCTTGA
CCGACTCGGCCTGGAGCCCGCCGCTGCTGCAGGAAAGAAGAGCTGGTGGAAGTTTTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62