GenePrediction:GLEAN_3457 Details

Name: GLEAN_3457
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:123775..125036 (+ strand)
Length: 1262
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:123775..123817 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_156:123884..124666 (+ strand)
Length: 783
Type: CDS
Source: GLEAN
Position: GCSC_156:124720..125036 (+ strand)
Length: 317
>GLEAN_3457 class=GenePrediction position=GCSC_156:123775..125036 (+ strand)
ATGCCTGGACGCGAAGTTTCCCTCGTCGCAGACAACCTCAGAGGTGAGAGGACAGGAAGACAGCTTCCTAGCCGACATGT
CCCGTCTTGCTAACCTCGCGGTGTCGCAGTCCTGGGCCAGGACCCGCTCATCCCTCCCGGTCTGCTGATCTCTGAGATCC
CCATCACGGAGTCGGCGCTCCAGACAGTCGTCAAGGGCCGCCGCGATGCCGTCAACATCATCATGGGCCGCAACGACCGG
CTGCTTGTCATTGTCGGCCCTTGCTCGATCCACGACCCCGCCACGGCCATCGAGTACGCCACCCGGTTGCGCGAGCTGTC
CAAGAAGCTGGAGAACGACCTGGTGATCATCATGCGGGCTTACCTGGAGAAGCCACGCACGACGGTCGGCTGGAAGGGCC
TGATCAACGACCCGGACATCGACTCGACCTTCAAGATCAACAAGGGTCTGCGCGTGTCCCGCCAGCTCTTCTGCGACCTG
ACCGGCACTGGTGGCATGCCCATTGCCAGCGAGATGCTCGATACCATCTCGCCCCAGTTCCTGGCCGACTTCATCTCCGT
CGGCGCCATTGGTGCCCGCACCACCGAGAGCCAGTTGCACCGAGAGCTGGCCTCCGGCCTGTCCTTCCCCGTCGGCTTCA
AGAACGGCACTGACGGCAACTTGGGCGTCGCCATTGACGCCATTGGCGCTGCTGCTTCGCGCCACCACTTTATGGGCGTC
ACCAAGCAGGGCCTTGCTGCTATCACCCGCACTGCCGGCAACGAGCACGGCTTCGTCATCCTGCGCGGCGGCACCCACGG
CCCCAACTACTCCAAGGAGCACATCCAGGCTGCCAAGGAGACCCTGTCCAAGAAGGGCCAGAAGATGGCCATCATGGTCG
ACTGCTCGCACGGTCCGTTCCGTCTCTCTGTCCTCTCATCCCGTTCATAACTGACAGCAACATAGGAAACTCGAGCAAGG
ACCACCGCAACCAGCCCAAGGTTGCCAAGTGTGTTGCCGACCAGCTCCGCGAGGGCGAGAAGGCTCTGATTGGCGTTATG
ATTGAGTCCAACATCAACGAGGGCAGCCAGAAGGTGCCGGCTGAGGGCCCGTCGGCCTTGAAGAAGGGCGTCAGCATCAC
CGACGCCTGCATCAATTGGGAGGACACCGTGACTGTGCTCGAGGACCTGGCGTCTGCCGTACGTGAGCGAAGAAAGGTGC
TGGCAGGCACCGCCACCGGCGTCGTGGACGACCCGAAGACGACTCTTCTGGAGGAGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62