GenePrediction:GLEAN_3459 Details

Name: GLEAN_3459
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:141299..144335 (+ strand)
Length: 3037
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:141299..141467 (+ strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_156:141571..141857 (+ strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_156:141905..142124 (+ strand)
Length: 220
Type: CDS
Source: GLEAN
Position: GCSC_156:142192..144335 (+ strand)
Length: 2144
>GLEAN_3459 class=GenePrediction position=GCSC_156:141299..144335 (+ strand)
ATGTGGCTACGAGACGCCCTTCCACATCACATCACCGAAGAGGATAACCGATCGCTGGCGCGTGTTATGACTTATGGCTA
CGACTCACGACTTTTGAACAGCGACAACTTTCATAATTTGGATGACCTCGCGAAGTCCTTTTATGACAGCTTTCTGGTCT
TGACTAATGGTCGAACCTTTCGGCCGATCATCATCTTGGCCCATAGTTTGGGAGGGCTAATCGTCAAGCAGGCAAGTTTA
TACACATGATACGCTAGACGCTATTCTTACAGACTGGCAGGCACTTATATCACTGTCGATTACCAAGGATGAGGGCTACC
AGGCGCTCTTCCAAGCGATGTATGGCATCGTATTTTTTGGAGTTCCAAATCATGGCATGGATATCAGTTCCCTCAAGCCG
ATGGTAGACAACAGACCTAACCGATTTCTACTCGAGTCGATTGGGCCCAATTCGCAAGTCCTTGGCCAGCAGTATGGCGA
TTTTCAAAAAGCCTTAGGAAAAGGCATGTTCGAGGTCGTCTGCTTCTACGAAATGGTCGAGTCACCGACAGCTGTTCAGG
TACGTCTACCCAAGCATCTGAAGTCGGTATATGCTAACATATGCAGGGCGAAAACGGTGTATGGAAAATGGAAGGGCCTC
CTGCCATTCTCGTAGCTCCCGAATCAGCTACACATTGCCGGCATTGGGAGGAGGGGGAGCAGTACAAATGCCCCATCAAT
CGAACTCACTCAGAAATGGTCAAGTTTGGCCCCCAAGACGCAGAATATGAGAAGGTTCTCCAACGAGTCAAACGCATTGT
CCAAAAAGCGCCCTTTTGCGCAAAGAGTATGTAACTAAAGCGCCCCTGAGAATATTTCGGTTGTATCTAGTTAGTTGTAT
TAAAACATTTTAGCCCCGATTCAGCCACGGCTTTCACCAAAGGAGCAAGAATGCCTACACTCGCTAGCCTTTTCGGAGAT
GAACGCCCGCGCCAACGACATTGACCCAGCCGTCGAAGGAACGTGCAAATGGCTACTCGAACACAGGAACTATACGGCTT
GGAAAGCTTCCGCTTCAAGCCTACTCTGGATCAAAGGAAAGCCAGGCTCGGGGAAGTCAACATTGCTCAAATACGCCCTC
AAGAATCAAGAAGCTTCAGCTAGAGGCAATGACCTTGTCTTATCATTCTTCTTCCACGGTCGCGGAGCAGACCTCCAAAG
AACACCTCTTGGCTTCTTCCGCTCTCTTTTTCACCAGCTTCTTAGTCGGGTCCCTGCTGCTCTATCTAGCCTAGTTGAAA
CCTTTCAAAAAAGGTGCGAGACAATCGGCCAAGTAGGAAAGTGGCAGTGGCATGAAAAAGAGTTGTGGGAGTTCTTCCAG
TCCTCTCTTCCGGCTGTTGTTGAGCACCATTCTGTTTGGATATTCGTCGATGCTCTAGACGAGTGTGGCCAAGAGAATGC
AAGGAATCTCATTGCAAAGTTTAACTCCTTGCTCAAAGCTCTTCAGTCCTCGCCTTTCACTGTCAAACGCTTTCACCTCT
GCTTCGCTTGTCGCCCGTACCCGGTTCAGACTTGGAACGACAATCTTGACCTGTGCCCCGAGCATTATAATGGGGGGGAT
ATCGCAACTTTCGTTGAGGCCCAGAAATTCTCACTCCGTTTGCAAGCAGCAGAGATTCCGACCCTAATCACAAGTCGAGC
CTCGGGCGTCTTTATGTGGGCGCGTCTTACTGCAGAGAGGGTCAGGAGCCTTGAACTCGAAGGTGCTGGGCCGAGGGAGA
TAAAAGACGAGATCGCTTCCATCCCTGAAGAACTTGATGCTTTGTACGATGGCCTTGTCAAAGGTATGAAGTCGGCCTCC
ACTAAGCTAATCTACTGGATCTGCTTTGCCACACGGCCATTGTCAGTGGATGAGCTGCGCTGGGCCATGGTAGTTGATGC
CGACTGCCAATATAACTCATTGCAAGCCTGCCGCAACGCCAAGGATGTACTGGACAACGACCAGCTGGAGAAGCGGATTC
AAACACTCAGCCGGGGTCTTGCTGAGTTCACGTCGTCTTCCGATACACAGGTTGTTCAGTTCATCCATCAATCTGTCAGT
GACTATTTCCTGGACAAAGGCTTGTTGGCGCTTAACGGCAACTCAATGCCGACCGAACTGGTCATCGGCAGAGCACACTT
TCAGCTGTCCAGAACCTGCATACACTACTTGGCGATGGAGGAGATCGCACTTTGCGAACTTGACGAAGTGTCCGCCTACG
ACTTGAAATTCAAGTTTCCTCTAATACACTATGCTACGACCTCGTTGGTACCACACATGAAGCAGACCGATGACCAGGGC
ATCCCTCAAGAAGATCTTTTTGATTCACTATCAGACGACTTTTTGCGCCCATGGACGCGCATTTACCGAAGAATAGAGGA
GTATTCAAACAACCGTCCACAAGAAGATATAACCCTTATACACATTGTAGCAAGATACGGTATCTTAGGGTTGCTTAATG
CTGCTAGAAAATCCCTCTCTGAATACACTACGAGCATCAATTCAATAACTAAAGATGGCCGGACGCCGTTGTCGTTGGCT
GCTGAAAATGGGCACGAGGCTGTGGTTAAGCTACTGCTTGAAACCGGCCAAGTCGACGTTGATTCGAAGGATACTGAATA
CGGCCGGACGCCGTTGTCGTGGGCTGCTAAAAATGGGCACGAGGCTGTGGTTAAGCTACTGCTTGAAACTGGCCAAGTCG
ACGTTGATTCAAAGGATGCTGAATACGGCCGGACGCCGTTGTCGTGGGCTGCTGAAAATGGGCAGGAGGCTGTGGTTAAG
CTACTGCTTGAAACCGGCCAAGTTGACGTTGATTTGAAGGATATTGTATACGGCCGGACGCCGTTGTCGTGGGCTGCTGA
AAATGGGCACGAGGCTGTGGTTAAGCTACTGCTTAAAACCGGCCAAGTCGACGTTGATTCGAAGGATGCTAACGGCCGGA
CGCCGTTGTTGCGGGCCGCTGAAAATGGGCAGGAGGCTATGGTTGAGCTGTTTCAGCGGTATGCTATGGATAGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62