GenePrediction:GLEAN_345 Details

Name: GLEAN_345
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1176625..1177756 (+ strand)
Length: 1132
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1176625..1176956 (+ strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_167:1177020..1177170 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_167:1177241..1177756 (+ strand)
Length: 516
>GLEAN_345 class=GenePrediction position=GCSC_167:1176625..1177756 (+ strand)
ATGACGCAGTCCGACCTTGAGGTCTTGCTCGAGATGGGCTTCGAGCAAGAGCGCGCGGAGCTTGCCGTAAAGAAATCCGG
CGGTCTTCAGGGAGCCCTTACTTGGCTGGAAAGCACCCAGGACACCTCTTTAGAAGAGCTGAGGGCAGCCGGAGCGGCAA
GCAAAGCGGCTGCGGCTGCGGACAAGGATGGCGAGAACTCTGATGACGAGGGCACAACTCAGGCAGCTATTACGGCCCTG
GAGACAAACCAGGAGGCTAAATCGCTGGTCTGCAACGAGTGCGGCAAGATGTTCCGCAGCCAGGCCACAGCCGAATTTCA
TGCAGCCAAATCGTATGTATTCTAGCCGATAGATATACGAATCCTTGCCCAATGATCTTTACTAACAATCGCCAGCGGTC
ATACTGACTTCGCTGAGTCAACTGAGGAGGTGGCACCGCTAACCGAAGAGCAAAAGGCTGCCCGGCTGGCGGAGCTGCGG
GATAAGCTGAAGGAGAAGCGGAACAGACAGGCCCTCGCCGATAAAGAGGATACGTTACGGAACGAGGTAAGTAGCCGATT
AGGGACAGGTTTATTGAACGGGGCCCGAAACTAGTCTGCTAACCTATGCTCGACAGAAAATACGTCTAAAGTCCACCAAA
GAATCGCAGGATCTCAAAGAGGATCTGCAGCGCAAGGAGCAGATCAAAGAGGCGGCTAAGAAGCGCGCCGAAAAGAAGGA
GGAGATCGAGGTCAAGAAGCGGATCAAGGCCCGCATCGAGGCCGACAAGGAGGAGCGTCGCCGCAAGGCCGAAGAAGCCA
AGGCTGCTCGTGATGGGCGGGCCCCGACACAGCCTGCCGCCAGTTCTGCAGCAGCGTCATCATCGGCAGGAGCGGGATCG
TCTCCTTCTTCCACTGCTGCGCACTCCCAGGCTCGCCTCCGTCTTCAGCTGCCATCTGGCAATGTGCAAAAAACATTCTC
TGCCGATGCGACTCTGTTTGAAGTGGCCCAAGCCCTCGAGGCCGACGACAGCTTCAAGGCCAGTCGCTTTGAACTCACCT
ACCCCCGTAAGGTTTTTGAGGGCCCGACAGATCTGAGCAAGTCGCTGCGGGAGCTAGGCCTGGTGCCCAGTGCTGTGTTG
CGGGTGCAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62