GenePrediction:GLEAN_3460 Details

Name: GLEAN_3460
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:145191..147330 (+ strand)
Length: 2140
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:145191..145494 (+ strand)
Length: 304
Type: CDS
Source: GLEAN
Position: GCSC_156:145577..145603 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_156:145695..145929 (+ strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_156:145997..146004 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_156:146066..146520 (+ strand)
Length: 455
Type: CDS
Source: GLEAN
Position: GCSC_156:146577..146909 (+ strand)
Length: 333
Type: CDS
Source: GLEAN
Position: GCSC_156:146959..147330 (+ strand)
Length: 372
>GLEAN_3460 class=GenePrediction position=GCSC_156:145191..147330 (+ strand)
ATGGCCTCTCTGCCAACGCCACCGCCGGAAGCCGAGCCGTCCGCAGGCTCCTCTGCCAATGGCAAGCTGGTTCCAGCAGC
CTCATCGGCCCCGATAGCCCACGACTCGGACTCTTCGACGGCCGGATCCAACTCACCGCTCCTGGGCTCCGGGGCGCCGT
CCGTGTCCTCGTCGACTGCGGCCTCAGCCCCCCGCATGACCAACCGCCAGTCGCTGGCCGTGTCCTTTGACAAGACCGTG
CTCAACATGCTCAAGCTGGACAACTACGACCTGGATATCCAGGAAGACGTGCTCGTCGTCGTTGGTGCGTCGCCTCTCCC
GTGATGAAACTACTATGCGCCAGTCTGGGCTGGTTGCTAACCTCGACGGGCATCCGCCCACTGCAGACAAGGAGAAACGC
AGGAAGAACCGGCGTACGTGTGAAATTTTGGCCTATCCAGTAGGGACTGCCTGTTTCCTTTGTCTCTCTCTCTCTCCTCT
GCTTCTGCTAATCTTTGTGTTCAGGCAGCAGCGGCAACACCTCTTACCGCCGGACGATCCCGCTCTACAACGTGCTCTGG
GCCGAGGTGACGGCCAGCACGACGACGCCGCCACAACAACGACTGGTAGTGGACTTTGCCGACCGGCTCTCGAAGACGCG
ACTGCACGTGGCGCAGCTGGTGGTGCCGGTGATGACGGGGCCGGATCGACCGACACCGGCGGAGGTGGCCACATGGGCAG
AGCTGCTGCTGTCGCGGGCGTACGGGCCTTAGAAGTGCCGATGCGACGACGGGCGTACGTTCTGGTGAATCCGCATGCTG
GACCAGGCGGCGCAGTGCGCAAGTGGGAGACAGAGGTACGGCCGGTGTTTGCGGCCGCGCGCATGGACCTCACAGTGGTG
ACGACGACGCACTCGGGCCAGGCGACGGAGCTGTGCGCGGCGCTGGACATTGACCGCTACGACATGGTGGTGCCGTGTTC
GGGCGACGGGCTGGCCCACGAGGTGTACAACGGGCTCGGGCGGCGGCCAGACGCACGACGGGCTCTCGCTCAGCTCGCCG
TAGCCCATGTTCCCTGTGGCAGCGGCAATGCCATGGCCTGCAATCTCTACGGCACGCATCGGGCCAGTCTGGCAGCGCTG
GCCATCGTCAAGGGTGTCGTGGCGCCGCTGGACCTCGTCAGCATCACGCAGGGTGACCGCAGGATGCTCAGCTTTCTCAG
CCAGGCTGTCGGCGTCATTGCCGAGGCCGATCTCGCCACCGAGCATCTTCGCTGGATGGGCGAGGCTCGCTTCACCTGGG
GCTTCCTGCAGCGCTTCATGGCCCGCCGCGTCTACCCGTGCGACCTGGCCGTCAAGGTCGAGATCGCGCACAAGGACGAC
GGTCCCGGGCCCATTACGCGCAGCAGCGCCAGCTCGAAAACAACCGGCGCAAAGAGCAGCAGCAGCAGGCGAGGCGGGGG
GGCCGCTCCAAGCTCGACTCGTCCGAGGCCACCACAGCCACCACAGCCACCACAGCCACAACTGCCACAACTGCCACATC
AGCCACCACAGCCACAGCTTCCACGACCAACACGGCCTCCACATCTGCCACCTCCACCAAGAGCGAGAACGGCAAGCTGG
CGGCCGACGACGACGGCCTGGGCCTGCCGCCGCTGCAGTATGGCACTGTTGAGGACGAGCTGCCCGAGGGCTGGGAGTTT
GTGCCGCACGACAAGCTCGGCAACTTTTACTGCGGAAACGTGAGTCAGCCCCTGTCTCTGCTGCCACATCTGCTGACCGA
ACGAACAGATGGCCTACATGGCTCCCGACGCCAACTTCTTCTCGGCCGCCCTGATGAGCGACGGGCTCGTCGACCTGGTG
ACCGTCGACGGCGACATTCCGCTGCACAAATCGCTCGGCATGATCACGTCCATCGACAACGGCCACTTCTTTGACAACCC
GGTCGTGCGCTACAGCAAGATCACCGGCTACCGCCTCGTGCCCAAGAACCAGGACGACGGCTACATCAGCATCGACGGCG
AGCGCATCGACTTTGCCCCCTTCCAGGCCGAAGTGCACCGCGGTCTCGGCCGTGTCATCGCCAAGCGCGCCGACCGCTAC
GAGGCCCCCGGCCCGCGCAACTGGGAAAAGGTCACCGCAGCCGAACGCATCATGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62