GenePrediction:GLEAN_3461 Details

Name: GLEAN_3461
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:178786..179466 (+ strand)
Length: 681
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:178786..179389 (+ strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_156:179455..179466 (+ strand)
Length: 12
>GLEAN_3461 class=GenePrediction position=GCSC_156:178786..179466 (+ strand)
ATGAGAGAGAGCTCATCAGCCAGAATCTGGCCAAGCCAGGAACAGCACCGCCGCCGTCGCGACCACAACATTACGCATAC
AATATCCGCTCGGTACTCGTCACCTTCGGGATCAAGCAGGCCACAGACTCCCTCCACATCACATTCACCATTGGCCGACC
CGATGGCTGCGCACGCCTCCTTGCCCTCACCGCCGCCATCTTCATGCAGTGAACGGAGGCCACGGACAATGGACATGGCA
TCTGGCCCACCGGAACGCTATGTTCCACCTCGCGCGCCTAGCCCGCCATCTCTAGTAGCAGCCAGCTTTCCGGCCTCAGC
ATCCAAGCAGCAGCCTACATATGGAGAGCAAAACCAGCAACAAAGGCAAATGCAATACCAGAACGGTTGCCACCTGCACC
GCCTGGCTGGCCAGTTTCACCCCATCACCCCAGACGCCTCACGAGAGCAGACTCCCGGAGCACCCCCCGAGCATTGGTGC
CTTGACTGCCGCGGAGACGGGGAAACCGGGCACAGAAAGGCGTGCCTCAAGGCTGGCAACGCCAGTAGTAGTAGTAGCAG
CAATGACAGTGTCCCGGAAGGACTGGGCAAGTGGGAACAGCAGCGTGAGAAGCCCAGACACCTATCACCCCTCTTCACCC
TCGATGTCACATGACTTACATATTCATAGAATCTACTGCCC

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62