GenePrediction:GLEAN_3462 Details

Name: GLEAN_3462
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:185694..186237 (+ strand)
Length: 544
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:185694..185885 (+ strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_156:186082..186237 (+ strand)
Length: 156
>GLEAN_3462 class=GenePrediction position=GCSC_156:185694..186237 (+ strand)
ATGTATGGCGTGGCCAAGGGCCTCGCTGAGCTGGTCGCTCCGATAGCCAGCTCATGCGACGACATCGCGCAAGCGTCTGC
ACTAAGGCACCCAGTTCGCAAGCAAGACAGGTGGGCGCCCGCTCATTTTACGCGATCCCAGGCTTACCAGGCCATTGGTC
TCCTGGAAAGAAGCAGAGAGGCGGCCGGCAGAGTGAAAAGGCACAAAGGAAAGGGAAAGAAAAAGAAAGAAAAAGAAAGA
AAAAGAAAGAAAGAAAGAAAAAGAAAGAAAGAAAGAAAAAGAAAGAAAGAAAGAAAAAGAAACCGAGAAGAAAGGAAACC
GAGAAAAGAAAACAAGATGGACGACAGAAAGAAAGAAAGAGGAAAAAGAGAGCAAAAGGTATGGCCAGTCTCTGCCCCAG
CTGCATTCCGGCCACGCCGCTCAGCATACGACATACTGCAACAGCGTGGAGAGGGAGACGAGCGCCGCAATGTCTCTTCC
CCCTTGCATCAGGTCTCGAGGTGGCCCACCGGACGCATCTCTATGTACGATGCCAGCGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62