GenePrediction:GLEAN_3463 Details

Name: GLEAN_3463
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:187122..189098 (+ strand)
Length: 1977
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:187122..187250 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_156:187307..187434 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_156:187502..187737 (+ strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_156:187802..188010 (+ strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_156:188073..189098 (+ strand)
Length: 1026
>GLEAN_3463 class=GenePrediction position=GCSC_156:187122..189098 (+ strand)
ATGACTGCCGAGGGCTTTTCTCTTATGGCCATTGGCCTCGTGTTCATCTTCTTTCGTCTCTTCACACGCGTCTACACCCT
AGGCTGGTCCGGCATCAAGAGCGATGACATCCTGATGATCGTTGCAGGAGTAAGTTCTGATCTGTTCCCTGAAAGCTGCC
CTGTCGTCCGTGCTGACCGACCTAGGTGGCCTATTCGGCCGAGACTGCATTGTCCTACTCTGTTACGACGTACTGGCTAG
GCCTCGCTAACAATGGCATGACCGATGCTGAGCGTGCTGCCCTCGATCCTTCCAGCCACGAGCATTATCTTCGGTTAGTG
GCAGTTTCACTCCAGCTTCAATATGTCATATTCCCATGGTTATTGGCGTTAACCTTACAGCGTCAATGGCTCCAAGACAC
AGGTGGCCGGCTGGTCAACATACACCTTTTTGCTGTGGACCCTCAAGGCGTCCATGTGCGCCTTCTATCTCCGCCTGATG
AAGGGGCTGGACTACCACCGGCGCATCTACATTGGCTTCTGCATCATCTTCACTAGCTGGGTAACCGTACTGCTGTCCAT
CTTGCTGGGCTGCCGGCCCATGTCCAAGAACTGGCAGATTTACCCGAACCCTGGGAGTATGTTTGCTGTCTCCAGATTCT
CCAGATTCTCAAACACAGGGCCTTCCTGCTGACTTCTCAGACTACTGCCAACCGGCCATTTCCCGCATTGACATCTTTGT
CACCGTCGTCCTCAACGTCATCACCGATGTCTACCTCTTGTCCATCCCAGTTCCCATGCTGTGGGCCGCCAACTTGCGGC
CGACCAAGAAATTGGGCTTAATTGTGCTGTTCTCCGGCGGTGCTTTTGTCACTGTCGCTGGAATTCTTCGCTGCGTTCTG
ATCTTGACGGTATGCTCCCAGCGCCCAACCTCGGGCTTCATGATCAAGGCTCGTGTAGCTAACAATCCCAGAATCCCGTC
ACTGGTGCCCAGCAGGCCGGTTCATGGGCGGTGCGCGAGACATTTGTTGCCGTCGTCACGTCCAATGCGCCGATCATCTT
CCCGCTGCTCCGACGCTGGTGCATCCCCATCTTTGGCAGCATGCACAGTAAGGCTTCGGTCCACGGTGGCCAACAGCATC
CATCAGGTCCGTCAAAGCAGAGCGCCACTGGAAGTGCCAGTGGCAGTGGAGCCAGTGGTGGCAGTGGAGTGCTGGGGCTG
GGCGCCTTGAGCAGCAAGCTGGGCTTCGGCAACGGTACGGGAAGCGATAGCAGAGGATTCGGCAGCAACACAGGCAGCAA
AGCGGGCATGTATGTGTTGGAAGAGAACGTTGGCGAGCACGAGCGCGGGATCGAGCACCAGATCACGGACGGCCTGAATC
GTCACCGTCAAAGCAGCATGGTGCCCAAGATCACGTTCTCAGAGAGCGAGGAGTGCGGTTTTGGCGATGGTTCCGTCATT
GACGACGAGGAGAAGCAGCAGCACCTGCCGCAGAGACAGTGGACACAGCCGCAGCCACCGGTACAGGTGCAGTCGCAGCG
GCAGCAGCCACTGCAGCAGAAGCGGAAGACGAAGGGGAAGCTGCGCGTGGAGGAGTACCAGATGACGGATTCGCGGCCGT
CGACGGATCAGCCGTACGTCACGGCGCTGTCGCCACCGCTGGGTGGAATTCGGATCTCGCGCGACCTCTCGCAGCAGCAG
CTGCCGATCAGCACCGGCGGGTCTGACACGTCTGGCGAAGACCACCTGGACAAGGTGCTGCAGAGCTCCAGCACCCGCAC
GAGCTACGGCGAGACCGGAAAGGCCGCCAGGACTGTCAGCGATGCCAGCAGCAGCGGCAGGAGCAGTGCTGGAATCTACG
AGGCTGCCTTTGCCACCTCGACGGCCTCGCCGCTATCCATGCCGTCGTGGTACAGCACCGGGTCGACCTTGGTCGGTGCC
GGGGCTTCGGACAACAAGCGAGGAAGCACGATGATGGGCGGGTCGCGCAAAATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62