GenePrediction:GLEAN_3466 Details

Name: GLEAN_3466
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:199767..202545 (+ strand)
Length: 2779
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:199767..199789 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_156:199912..200038 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_156:200137..200267 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_156:200329..201411 (+ strand)
Length: 1083
Type: CDS
Source: GLEAN
Position: GCSC_156:201496..201685 (+ strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_156:201750..202358 (+ strand)
Length: 609
Type: CDS
Source: GLEAN
Position: GCSC_156:202412..202427 (+ strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_156:202487..202545 (+ strand)
Length: 59
>GLEAN_3466 class=GenePrediction position=GCSC_156:199767..202545 (+ strand)
ATGGTTGCGCCCGCCGTGCCCGAGTACGTCTCTCCCGTCCACTGCCCGTGTTCACCCCTGTCTTCCCCCGTCCGCAATGC
CACCCTTGCTCCATCGTCCCCATTGGCAGCTGTTCCTTGTCTAATCCACCGTCGCGTGCTGCCAGAATCACCGAGGAGGA
GGTCCACGAGTCTGTCGAGAGCAGAACCGAACAGCTGTTGTCGCTCCGCGAGCTCGGCCCACCCGATCTCGTCCATCTGG
TCAGGCAACCGATCCGCGGAACTGGTCGCCATGTGAGAGCCACTGGAACCCCTTTTTCCCCTGCGAGCCATTCCCCCTCC
CCACAGCAATCCACCCGTGCTGACGACGTCGGCGCATCTCGATCATCTAGATTGGCGTGTACCATCATGTGACAGGTGTC
GACGCATCCTCCTCGGCCAGCCTGGCCGCCTACATCAACACCCTGACGTACCGCGAGCCCGGCACGACTGCCACGACCAA
GATCAGCGAGGGCCTGTACTGGTAGGCGACGACGGCGAGAGACGGAGAAGGCCACGTGACGCGCCACTGCTGACACGTCT
AGCTGCTACAATGCGCTCTCACGGCTCGACATGCGGGTGCACGTGACAATTCCCGGAACAGTCGAGAGCTACTGCGTCGA
CGAGCGGGGCGAGAAGAAGAAGGCGTCGGACGAGCTGTGGCTGGAGACGTATCTGTGCAGCGTGTTGCGGGCGTATTCGT
ACGCCGACGACGGCAGCGGCGAGACGATCCGCAAGATCATGGGCGTGCGGCGCTTCAACCCGGTGACGAACACGGAGACC
GAGCACCGCTTCCTCAACGCGGCCGAGCAGCTCTTCTTCCGCGGCTGGCAGCTGGGCTCCGACGCCACGGTGCAGGTGCC
GACGGTGGTGTCGAATCACCTGGTCAGCGGCCTGCTCAAGTACTTTGAGACGACCGGCCGCTATGCCTCGGGCATCAACC
TGTTCCAGAAGCTGCGCACGCAGAACGTCGAGGTAGCTTCGCTGCTGGCCAAGGTACTCTTCATGGGCAACGAGGAGGTC
GACGGGGTGCGTGTGCTGCACCGTGCCCTACAGGAGGAGCCGATGGACTACGTCATGCTCGACACCCAGGCCGCCTTTCT
GTTGCGCAAAGCCCGCACCGCCGCCACGGCCGAGCAGAAGGAACAGCGGCTGCGCATGGCTCTCGGCTGTGCCGACCGCA
GCACCGTGGCTGCCCCGAGCGAGTTTGGCACGTGGGCTCGGCTGGCCGAGGTGTACGTGGCCCAGGAGGATTGGGAGAAC
GCGCTGACGATCCTGAACTCGTGCCCCATGTTCACGTACCAGGACAAGGACTCGCCCCAGATGCCCGAGCCGAAGGAGGT
GTCGCTGCCCATCTTGCCAGAAACCCGGCTGGACGAGCTCGACGGCGAGCTTGACTCGCGCTACAACGATCAGGTCGACC
CCAGCCTGCTCGGCCTGCGTGCCGCCGCCTACCGCGGCACTTTCAAACACGCCTACAACATCCTGACCGAGATGACCGCC
AAGATCGGCTGGGACCAGCTGCTGAAGATCCGGAGCAACGTCTTCGTCATGGAGGACGAGTACCGCACCGAGAAGAAGGA
GGGCTCCATTGCCTCTTATCCCGTGACCCAACAGGCCGCCCAGGCGTCAACTGCCACTGCCGCTGCTGCTGCGCCTGCTG
CTGCGCCTGCTGCTGCGCCTGCTGCAAGCGACACGAAAAACAATGCGAGCACGGATGCGCTTCGGGGCACGCCCGACCCG
CAGACAAACGGGCACGACGACGGCGACGATACCGGCAGCGCTGCCGAGAGTGAGAGCAGCGCGGACGAGGACGACGATGC
GTCCAAGATCGAGGGTGACGACCGGTCCGGGGTCGAGAAGCCGAGCACGGCGGCCGATGCGGGCGAGAAGGAAGAGCATG
TGAGTACAGACGAGAGAGAGAGGTAAAGAGAAAGAGAAAGAGATCACGTGACTAACAAACCAGGGCACCGCCATTGAAGA
GCACCTCTCGCGGCTGAACAACAAGCGGCTGTGCGAGCGCTGGCTCGACAGCTTGTTCATGGTGCTGTACGAGGACCTGC
GTGTGTACACGATCTGGCGCACGCAGATGGCCCAGTACCGGGCGCAGCAGATGCAGTACAAGAAGTCGGCCGAGGAGTGG
GAGATTCTCGGGCTGCTGGCCGAGCGGCTGCAGCACGCCGACGAGGCCGTCGAAGCCTACCGCGCCTGTCTGGCCCAGCG
CTTCAGCCCGCGTGCCATGTCGGGCATCCTGCGGGCGCTCAAGACGGCACGGGCGGGCAGCAGCCGCACAGGCAGCACCA
GCAACGGCCACGGCAACGCGAACGGCACGGCGAGCACGGCGTCGCCAGCAAGAGCCGCCGGCGGGTCGTCTTCCCATCCG
ACGCCGGTGGCGATGCCGCAGCCGGCCAGCACGGCCGAGACGGTGGCGTCCGTGATCCGGCTGGTCACCTGGCAGTATCG
GTGGTATTCGGGCTTCTCGCCACAGCTGCTGCAGACGGTTCGCGTCCTGATCGAGGACGAGGGCGCGGTCAAGGTCGGCA
GCCTGGTGCAGGCCACAAACTTGCCGCAGCACGTGCTGGACCTGACGCACCACTATGCGGCGCTGTGCGCGACTTTTCAC
AGCAGCGGTACGGACGGGTAGGTCGGTGGACACAAGGGGGAGCGCATGACAGATGAGACGGAGACGCGCAAACGGTGAAG
GTTACGGAGAACGGAGGGAGAACGGAGAACGGACGGAAACGGAGTGCAACGATGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62