GenePrediction:GLEAN_3467 Details

Name: GLEAN_3467
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:210285..211153 (+ strand)
Length: 869
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:210285..210361 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_156:210673..210782 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_156:210852..211153 (+ strand)
Length: 302
>GLEAN_3467 class=GenePrediction position=GCSC_156:210285..211153 (+ strand)
ATGTCCACTCGCAAAAGGAAGCAGGCGGATGAGGAGCTCGTGGCTCTTCCCAGCGGTGACGAGGAAGAGGAGGAGGAGTG
AGTATTTTCCCGCTCGAAAACCAATTTGTGACCAATCACAGAAACATTTTCCTGCTCGTTCTGCTTGCTTGAGCTTTCAG
AAGTGGCTCTTTTCGTCAAGCTCCTGTGAATTGCGCAGTGCCCCTCTTCCGATTGTTTGCTCTGCCTTGTTTCGAAACTT
CACAGCGGAGCCTCGAAGCTTTTAAATGCATCTATCGTCTAATCTTGCTGTTGTCTTTATGCTGTGGTCTTACTGCTATA
TCGTACTCACTGTTATTTATATTGCGCACTTCATGGAGTGCACGGTGACGCTAATTTGTCGTATGAAGGTATCTGAGTGA
CGGAGATGACTTCGAGGAGGGTGATGACAGTGACGAGGATGACGAGGAGGAAGAGGAAGACGAGGCTGAAGCTCTTGAAG
AGGAGAAAAAGACTCCTGGTAGGATCGCTTCTTCTTCCGCATAACTTGTACTATTCTGTATTCATACTGACATTTTTTAA
TCAGCAGCTGTGCATCCCAAGAAGAAGCAGAAGGTTACCTCTACTAGTAATGAGCCTGTCGCCAAGAACGGCAATGGCGT
GGTGAAGAACGGGACGACGGTCGAGGACGAAGGCGAGGAAGAGGAGGAAGACGCCGAGGGCGATGAAGACGATGTGCCCG
ATGACGTCTATGATGAAAAGGCTGATAGCGATGTTGAAGAAGTCACTGTCAAGAAATCCGGCAAAACAGCTGACAAGACC
GTTCCATCTTCCGCCGGTGAAGAGGTTGCAAAGGAAGAGATCATTATCGATGGTGACGAAGAGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62