GenePrediction:GLEAN_346 Details

Name: GLEAN_346
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1179804..1181427 (+ strand)
Length: 1624
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1179804..1180017 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_167:1180079..1180308 (+ strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_167:1180366..1180461 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_167:1180542..1180922 (+ strand)
Length: 381
Type: CDS
Source: GLEAN
Position: GCSC_167:1181125..1181181 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_167:1181239..1181427 (+ strand)
Length: 189
>GLEAN_346 class=GenePrediction position=GCSC_167:1179804..1181427 (+ strand)
ATGGAAACCCCGGCTATTCCGGCGCCGCGAGATGCTAATGAAATCAAGATACTTGCCAATCTTGAGTCGACTCGCGACCA
GCTACTGCTTCTGAAGCAAGATCGCACCAAATACATTCGAAGCCAAGATGTCATTCGGCTATATGACGAAGTTATCGAGC
AAGTGCGCCTGCTGAATCAAGCCCGCGACGGGACGAAGGTTTATGAGAATCGCCGTTAGTGCCCCCCATCATTGTATAGT
ACTTGACAGTGACTGACAATAATGCTTCCGTCTAGTCGACCGTGTACTCGACAGCTGCTTCCAGCTTCTCTCCCTGTTCT
TTATGACCATCGGCCGTACCAACGAGGCTCCCGCTGCCTATGCGCTGACGTCTACGATCAAGCGCCTTTTAGATCATCTC
ACCGAGGCAAAGGTCTTCTCTGCCAAGGACCTGGATAGCCTTACGCATACTCTGAGCAAAATATCTCATACTGTGAAGAA
TGCCGATGACTGCTCGCCGTTTTTGGTAGAGCTTCTCTCCCATCGAATCGAATTATGCCAAACGTCTCTTCATAAGTTGC
AGGCCATGGTACAGAAGCTGGGGCCCCCGCTGCCTGCGATTCATGAGAAGCTGGTGACTATTCTGCGGACCATGGCGCAT
GCAAATACCAAAGCTCGGGTACGTTTTGCCTCTCCTGACCCTTTCCACTTCTCATGTTGTTTAGCCTTATTACTTACTTT
GTGTATTTTGGTGTCCAGTTTTCAGCATCTGAGGTCAAGAAGCTGCAGACACAACTGAAGGAGATTGGCGACAAACGTGT
CGACGAGAAATTTCAGAACGAGAAAGGCGAGGTTCCTGCAGGAAACGATGAGGTAGTCGAACTGCTCGATAAGTGCCGCG
CTTGGTCTGAACTTTTGCTCCAGAGGAAGGGAGTCATCCCGGATAACTTCAAGCCGATGTATGGAACCCTTGTCGGAATT
CGGAATGACCTGGAGAAGCTGTCCGTTACTCAGGCATGGTCGTTGCGAGAGACAGATCTGTTTGATTTTCAGCGCCAGTT
GGATAAGTTCGACGAAGCAAGGATAGATGGAAACTGGGTCGATGACGACGGAAACCCGGCTGAGCTTTACGTCCAGCGAG
TAAGTATTTCTTGGCATTGTTCCGGGGATTTGTGGCCCGCGTTAATCCGGCAATCCACTGACGAGGTGGCAGACTTTCCT
TTACCTAATCCGACGAAGTTATGGACTTGTTTATTCTCTCATGATATCGTCAGAGCCCGTCTCAGAAGCACTTTTGCCCA
TTTACAACCAACTGATGACTCTCAAGCGATGCTTATTGGAGGTGAAACATTCAGGCGGAGTGTCTTCGCCACGAGAGCTG
TACCCGTACAGCATGAAGGTAAGCGCATCTTTTTATGCGACTCTGGCTCTGCCATGCTAACTTGCCGGCTTGTAGCTCAA
CTCGATAGACAACATGCGCGTTGACGGAAAGTTTATGGTAGCGGACGACATCCCGGAGGGGCAGGGAAACGTCACAGAGT
TGTTGTCAGAGTGTTTCGATCTAAATTACGAGTTGAGGCTAATTGCCGAGGAGAAAGCTGAAGGTGGCAGTGAAGGGGAT
GACAAGGAATCCACCAGCGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62