GenePrediction:GLEAN_3471 Details

Name: GLEAN_3471
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:250821..257098 (+ strand)
Length: 6278
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:250821..254980 (+ strand)
Length: 4160
Type: CDS
Source: GLEAN
Position: GCSC_156:255040..255555 (+ strand)
Length: 516
Type: CDS
Source: GLEAN
Position: GCSC_156:255794..255859 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_156:256409..256709 (+ strand)
Length: 301
Type: CDS
Source: GLEAN
Position: GCSC_156:256769..257098 (+ strand)
Length: 330
>GLEAN_3471 class=GenePrediction position=GCSC_156:250821..257098 (+ strand)
ATGATCAGCCGCCTAAAGGTCGGCCTGCGAGGAGAGAAGGCCGACGAACGAAACCGCGTGCGGGAGACTGGAGAAGACGA
CAGCGAGGCTGAGACGCCTGTGCAACAGACCCAGCGCAAAAATCTTGTCGCCGCCAGCCGATCTTGGTTCCATCGCGCCG
TCACCGAGCTGATTCTGCGCCGCACAACCCTGCCGCCGTCCAAAGATGGCCGCCACATACCGCTGCGTCTGACCGACGAA
AGCGCCCGTCCATCCCAGCTTGTCGATGAGCGCCGTAGCCATGGCCGTGGATACGTGGCAAATGCCATTCGCACCTCTCG
TTACACCGTGTTCGACTTCGTCCCCAAGCAGCTGATGTTCCAATTCACGCGCGTCGGCAACTTCTACTTCCTCTGCGTCG
GCATTCCTCAGACGATCCCCGGCGTCAGCACCACCGGCAACTTCACCACGATCATCCCGCTGCTCGTTTTTGTCGCCCTG
ACTGTCCTCAAGGAGGGATATGATGATTACAAGCGCCACTGCCTCGACAACATCGAAAATGCCTCCATTGCGACTGTTCT
TCGGCCGATTGACGAGCTCCCCCAACACGGTCAGAAGTGGTGGTCAGCCTTCGTCGCGCTGTTGCTCTCGCTGCTGTCCC
GGCTGATCGGTAGACGCAAATCAAGATTCACGTCCGGAAACGTAGGTGGCCGAAGGAAGCACGTCGTTGACAACGAAACC
TTTGCGGGCCTTCACTGGACTGGCATTCAATGGCGCCACATCCGCGTCGGCGATGTCGTCAAGCTCTCCCGGGACGAAGA
GGTCCCTGCCGACGTGCTGCTGCTGCATGCCGACGGTGAGGGCGGATTGGCATACGTCGAAACCATGGCTCTCGACGGCG
AGACGAACCTCAAGAGCAAACAGGTCCCTACTCCTCTGGCCGACGGCCGCTGCGCCTCCATCGAAGGGCTGGCTTCGTGC
TCTGCGGAGTTCGTTGTCGAGGACCCTAATCCTGACCTGTACCATTTTGATGGTCGGATCACGGTCGATAAGGAAACGCT
TCCCCTCACGTCGGCCGAGGTCATCTATCGCGGCTGCACCGTGCGGAATACCCAGACCGCCATTGGTCTCGTCGTCAACG
CCGGGGAGGAGTGCAAGAGCCGAATGAACGCCAATCGTCATCCCAGCGCCAAGAAGCCTGCTCTCGAGCTTGTCACCAAC
GGCATCGTCATGGTCCTCTCGTTGTATGTCATCTCCCTGACCACTGGTTGCTCCATTGGCTACTATCTTTGGCATCGGAG
CACTGAGCGCATCTCCTGGTATCTTTCCGATGCCACCGTCAATGCCGGCCAGATTATCGTCGGCTTTGCCATTCAATTCA
ATAACGTCATTCCGCTTGCTCTGTACGTCAGCTTGGAAATTGTCAAGATCGGCCAGATGCTCCTCCTGAACTGCGACGCG
GCCATGTATGACGAGGCTTCAGACACGCCTGCACAGTGCAACACCAACACAATTCTGGAAAATCTCGGTCAGATTGGATA
TGTTTTCTCGGACAAGACGGGCACCCTTACCGAGAATGTCATGAAGTTCCGGAAGCTAAGTGTGGCTGGAACGTCCTGGC
TGCATGAAGCTGATCTCCAACAGAAGACTTACCAAGGAGCAGGCCAGGAAGGAGAACAGGATCGCCCGCGCAACAGTCTG
CATATGGCACCATCCAGGCTGTCGACGTCATCAAGAGTCTTTTCGCCCCCTCGTGAGGATCCCCCAGCAGCCGATGCCTC
ATCGGTGCTCTCGCCCATCCAGGATGGCAGACGGTCGTCATCGGTCTGGCGCTCGACCGGCCGACCCGACCATGCGCAGC
CTGAGCTCACGACCGAAGACCTCATCGAGTACATCCGGCTCCGACCTTATACGCCATTCTCGCGGAAGGCTATCACGTAC
ATTCTTGCTTTGGCCCTCTGCCACACATGCATTCCGGAATTGGAGGATGGTAAGGTTCTCGGCTTCCAATCCTCTTCCCC
GGACGAACTCGCCCTAGTTAGTGCAGCAGAAGAGCTGGGTTTCCTTGTCGTGCAAAAATCGGCTCACTCGACGACGTTGC
GCTTTACCTACACGAATTCCGAACACCCGCCCGAGGAAGTGTACGAGATCGTCGACGTCATCGAGTTCAGCAGTCAGCGG
AAGAGGATGTCCATCATCGTCCGGCGTCCTGACGGCCAACTGTGGCTGATCTGCAAGGGCGCCGATTCTACTGTGTTGCC
CCGACTGAAAATGGCGCCCTTGGCGATGCAGAAAGCCCGCGATGTCCGCAAAAGCGCGGATATGGAACGACAGATGATTC
GCAACAGCGAGCAGTATGAGCCCAGGAGTAGCTTCGGAGGGCCAGCAAGCGTCATGATACGCAAAAGCATCGGCGCAGGG
CATCGTGACAGGTTGGATAAAGATGGAAACGCGATTCCCACTCTCACAATTGAGCCAGGTGGTAGCTCGTATGGCGGGCC
GCGGTTGTCCATGTCTGACCGGAGTCGTTCGTTTGATATGCAAAGACTTCCGAGGCGGTCAATGGACGCTTTTCGGCCAC
GTCCGACATCGATGGCTCGCGGGCCCTCCTTGGACATACCGTCTGGCATGGTGAAATCCGATGTCCAGAGATCCAGTTCA
TTGGCTAACCGGCCATTGCGGATGCTTGTGCCGGCGGTGCAAAAGTTGCAGCAGCGGCCTCCCTTGCCGGATAAATTTTC
CTTTCTTGAAGACGCCTCGTTGCCAGAGGGCGAGGGCGGCATCTTCGAACAGTGCTTCAAGCACATCGACGATTTCGCAG
CCGAAGGTCTGCGTACGCTGCTCTTTGCCCACAAGTTCATCTCAGAAACCGAGTACCGGGCTTGGAAGAAGGAGTATCTT
GCGGCAGCAACCAGCCTCGACGACAGACAAGAACGTATAGAAGCGGTCGCCGAAACTCTGGAACAAAACCTTAGTCTGAT
CGGCGCCTCGGCTATTGAGGACAAGCTGCAGAAGGGCGTCCCAGAGACTGTCGACAAGTTCCGTCGCGCAAATATCAAGA
TCTGGATGCTTACGGGCGATAAGCGAGAGACGGCCATAAACATTGCCCATTCTGCACGAATTTGCCGGCCGGCGTCTGAA
ATATATATCTTGGACGCATCCAGGGGCGATTTGGCCGGCCAAATGCTGCACGTGGCTGAAAGTCTTGGACTCCGTGATGT
GGGCGATGTCGCTGATGTTGTCGCTGCTCCTGGCGACCGACTCTGGGACTCATTCTCGTTTTGGCTTGGCCGATCAAAGG
CATGGAAACCACAGCAGCAACGCAGGAACCACACGGTAGTCGTGATAGATGGTCACACCCTAGGGATCATTGAAAAGCAA
CAGCAGAATGCAGGCAAGAAAGCAACATCAGCGTCCATTTTCTCAGCGGACGCGGACCTTCGCGAACTCTTCTACACCAT
CATACCCGAAGTCGATTCTGTTATTTGCTGCCGCGCTTCTCCCTCTCAAAAGGCGCTGCTCGTTCGTAGCATCCGGCAAG
GAAAGGAGACTAGCAAACGACAACGCCAGCAGAACCCAGGCCTTACTCTTGCTATTGGAGATGGCGCCAACGATCTGGCC
ATGTTGGCTGAAGCCCACGTCGGAGTTGGAGTGTCTGGACGAGAGGGTCTGCAGGCAGCACGCGTGGCTGATTACAGCAT
CGCACAATTTCGCTTCTTGGGTCGGCTGCTTCTCGTCCATGGGCGTTGGAACTATGTGCGTACAGCACAGTTCATTCTCA
GCACGTTCTGGAAGGAAATGTTCTTTTACACCCCTGCTGCGGCATACCAGTGGTACTGTGGCTACACAGGCACTTCGATA
TATGAAAGCTGGAGCTTGACGGTGCTCAATACCCTGTTCACCAGTCTGTGTGTCATCATACCGGCGATCGTGGAGCAGGA
CCTCAGCCAGACCGTTCTGATGGCTGTACCAGAGTTGTATTCCTTTGGGCAGCGTAACCGTGGGCTCAACCCATTGAAGT
ATGTTTCTTGGATGTTGGTAGCCGTGGCCCAAGGTGTCCTGGTCTGGTTCGGCTGCTGGGCTGGCTACGGTGCCTTTGCA
AACAGCAAAGACACCGGTCTGTTCGCTCTCGGAGACCTCGTTTTCGCCGCGTGCATTATGTGGACCAATGTCAAACTTTT
GTGAGTCGATATTGCTAGGAGTGGCGAGTTGTTTCTTCGACAATTACTAATCGGAGCAGCATCCTGCACACGCACCACAA
ATCGGTTCCTGTGTTGATCGGTTTCTGGCTCACCGTCTTCGTATTGTGGTTCTGGAACATATTTTTGTCGCTGGCACACA
GCGCGTCCCCATCTCCGTACGACGTTCGAGGCGGATTCTTTCACGAGTTTGGACGTGATTTGTCGTGGTGGCTGACCCTG
ATCATTGTCGTGACGGCTCTTACCGTGATCGATCTGAGCTATGCTGCTGTCAAACGCAACTTGCGCTTTCGTAACATCTG
GCAGAGTAAGGAGGGACGCCAAGGCAGGCATCTGTTGCTGTGGCCGCCGGCATTCTGGGGACGTAAAAGGTCGTCTTCGG
ATACAAACAACGAGGACAGCTGCGCAGACAAAGACGACACATCGGACGATTCTGCAAGCATGGAGATGCCAGCAGACGAG
CTGGATCTGGAGGTGTGGCAAGACCTGGAAAGAGATCCTGCCGTCAGAGCGAAGCTGCGGCAAATGAGCGGCGAAGAGGA
CGACGAAGACGACTGGTCTTGGGGCCTCAATTGGAAGAAAAACAAAGGTGAAAAGAAAGAGGGGGCAGCATGGGAAGAAA
GTCGCTGCGAAACGGATGGGGAATGATCCGTTTTGGAGCGTTCTTTTGGTTATGGAGTCTGTCGCTCCTTCTGCATTTGT
ATTTCAATTTCAAGATACCCCTTGCGAAACTCGTATTTGCCATGCGGCCGTCTTTGTGCTTGAAAATTGTACACTGAATT
GGCTGCTCAGCAGTGATAAGGATGAGAAGGTTTGCCTGCACATTACGGAGTACTTCTCAGCTGCCCTCAGCAAGTTCCTG
TATGTCTTCTATCTACACTCTACTCTTCAACAAGTAATCCGACATGGTGTAATGGCTAACATCGGTCGCTCTCACCGACC
AGCTCGGGGTTCGATTCCCCGTGTCGGAGCTAAAAGCGCCTGTAAGGCGACGATTTTTTGCACTTTTTTCGTCTGGTTTA
GCACGTTTATTTACAAACTCTGTTACATTGACCACCCAAGCAAGGCTGGCCCAAATTTTGCTATTTTACTTCGTGCATAC
GGCTCTAGATCAAACCAAGAAATTGGGACAAGTGTAGTGGCAAAAAGGATTCTTCCTTGTTCAATCTATGCCGATTGGTG
CACAAAAAAAGTCGCATATGCGGCGAAACATCAAAAATGCCAGCTACAGGGTTCGAACCTGTGAATCTTTCGATAATGGT
GTTTTAAACTATAGGGCTTAAGACCACCGCCTTAACCACTCGGCCAAACTGGCAAGTTGTAAGAATTTTGTTAGCATTCT
GAGACTATTTAGGCATTTCAAGTGGGACGACGATCTAAGACCTGGTTCACATGCTTCAAACCCAGCAGACCAAGCCGAGA
AGCGAACTGCGAGCATCCAAACACGGACACGACGGCCGAGCCGCTGGCCGGGATCGTGCGGAAGCACTTGTCTGGCGCTG
TGGGCCTACAGCCACCCGACCTCACGACTGTGCAGACGCTCGTGGTGCTGTCGAAGTACGACTGGGGCGTCGGCTGCGGA
TACCGTGTGTGGATGTACGCCGGCATGGCAGCACGTATGGTGCAGTCGCTGATGGTGCTAACACGACCGTCGAAACTGTC
GGCCATCAAGCGCGATGAGCACAGCCGCATGTTCTGGAGCTGCTTTGTCGTGGGCTAGAGCTGGTGGATGACTATCCAGC
ACTGTTGCGCCTTGTTCAAAAACGCAAGCCGCGACTGTCAGCTGTTTCACGGCCGCACGCGCGCAAATTTGAGGCCCTCG
AATACTCTATCCACGACCCGAGCGGACAGCCGCCGACAGAGGGCGAGGTCATCTTGCCGGCCAGCTCGGCTGGTCAGAGG
CCGTCACGAAGTGATTTTAGCACGACCGACGGCATGGTCTTATCGGTCTTGTTCAGCCCCAGCAGCATCCATGACGTGGA
GGCGGAAGAGCCAAGCCAGCCCCAGCCGCTGTGGGGGGAGCAGCACACTATTCCGTTTGCCCTCGAGGGACTGCCGCTGG
ACTACAACCTCGATATGCTGGACATGTATACAACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62