GenePrediction:GLEAN_3473 Details

Name: GLEAN_3473
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:268907..271848 (+ strand)
Length: 2942
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:268907..268910 (+ strand)
Length: 4
Type: CDS
Source: GLEAN
Position: GCSC_156:268970..269094 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_156:269159..270081 (+ strand)
Length: 923
Type: CDS
Source: GLEAN
Position: GCSC_156:270414..271848 (+ strand)
Length: 1435
>GLEAN_3473 class=GenePrediction position=GCSC_156:268907..271848 (+ strand)
ATGGGTATGTACTGGGATATTTTCCCTTAAACGGCAGCATAATCTGAGATCTCAGATTTACAGTCGTGGCGACTGTACGG
ACGGCAGCCAAAGGCGAGGCCGTTCTCGATTCCATCGATGCACGGCTGCGCCCCGCCGTGTCGTATGTTCTCGTGAACGA
TGTTGCGCAAGAAGGTGCTTTTGACAGGGTGAGAAGTGTTTCTTGCGAAAAGGAATCAGATGACTTCACTGCTGACGCCT
CAAACCGTCCAGGCCGTCCAGGCAGAGCCACCATTTGATTTTGTCATCCACACGGCCTCGCCGTATCAGGTGCGCATCGA
CGATCCTGTCCGGGACCTGCTCGAGCCGGCCATCCGCGGCACCACCGGCATCCTGCGCTCTGTGCAGAATCATGCCCCCT
CAGTGCGACGCATCGTGTTAACGTCCTCTTCAGCCGCCATGCTCAACCCGGCTGCCCACGCCGCCGTGTACGACGAGTCT
TTCTGGCGGCCAGTCACCTGGGCAGAGGCACAGCTGCCACAGAATGCCTACGAGGCCAGCAAGGTGTTTGCAGAGCGTGC
TGCTTGGTCAACCGTGACCGGTGCCGATTTAGAGACAGCGGGCGAGCCAGCGGGCGATGCCAGATCCCTCGCTAGAACCC
CCGCTTTTGATCTTGCTGTCATCAACGGAACGTACACATTTGGGCCAGTACAGCGGTGGCTGAGGGGCGCCAACGAAATC
AACGCATCCAACCACCGGATCCGCGATCTTATCGCGGGCGGCTGGCTGTCCAGCAAGACGGACAGCACGGGAAAGCACAG
AAGCATGCCGCCCACTCGGCCAGTCTTCACATGGGTCGACGTCCGTGACGTGGCGCTGGCCCATGTGCGCGCTCTGCTGG
TGCCGCAAGCTGGTGGGCGTCGCTTTTACGTCGTCGGTGGCCATTTTAGCAACGGAAGGCTGGCACACATTGTGCGTGAA
ATGGTGGCAGAAGCAGAGAAAGAGTCGGCATTGAGCCCACTGGTTAAGCGCATTCCACCGCTTGCCGATACGCCTGATGA
TCTGCCGGCAGACGTGTACCGATTCAACAACCGACGGTCGCGTGAAGTTTTAGGATTGACGTATCGCAGCCTCGAGGAAA
GCGTGATGGACACGGTGTACTCGATTTTGTCGTTGGAGGCAGCTGGGGCCGAAAAGTAAAGACCGTATGCGCGTAAGGTA
GTTTTGATGGTGTGCAAAATGTTTTCATGTTCAAAAAGAGGAATAATATTAGCCGTGGGGTTGGACAATGATTCACGGTG
TCTGGCTTTAAAATGGACGACTTGCCGTATCGAGCTGTTTGTCGGGGCTTTCTCGGTGCTGGAAATCCATTCACTTATTG
CATGCTCAGCTCGAGATCACCTTTCTTTGACTCTTCCAGAAAACAAACTGGTTTCATCGAGGAAGACTATTGCTAGTATC
TGACATCTGTACCACGGCTTTGCTCTCCGATGGCCTTACTTTAGATGATCTGACAGACGGGATACAGACAGCTCAACTTC
ACTCACTCGAGTGGTTGTGCAAACGGCTCAATGGAGACGTACCAGGTATGGAACAACTGTCTCGATACTTCGGGACAGGC
AGGCCCAGAAAACCCGTTCGATCCTTTCAGGCCCGAGGAAAGATCGTCTTACCAGACTTGGCAGCAGCAGAATCACCAAC
AAGATAGCATGCAACAGGACCTTCCAGGCCCCCAAGACTACCAGGCAAACATGTGCAGCAACAGCTTCTTTCCCAGCCAG
GGGACCTTTCTTCTGCAAGCCCCGACCATTCCCAACATCATGTATCCAACAGCGACTTACCAGCAGCCTACTCAAGGGCA
GATGACCTCCGTTGGAGTGTTTCCAACGATGGAACAGGCGCCCTCGGATTGCCACAGAAACCCACTGCCTGTCCCGCCCA
GAAGTGCAAATGCAACTGACGACGAGCTGCTTCCCTGGCTTTCCTCCCAGAGCGTGCCAACCAGACACGAATATTCGATC
CAGAGCATGACTGAACTTGTGAGCAGCCAGCAACCGTGGCACTCCTGGTCACAGAACACGCAGTTCCAGCAGCAATTCCA
GCAGTGCCCACGATTCGTTCCGCCCGTGCAGATCTCGTCCGGAGGACTGTTGAGTCCAGATGGCTCCGGCCTGCAGAGAG
AGCGACCCCAGACGCCGGCAGCACACCGGAACAGCAAAAACAACAAACACAGCAACGCCGCATCTCCTTCCGCGTCAACG
TCGTCCTCGCCTCCCTCACCCGAAGAAAAGATCACATTGGCAGACGTCAATCGATTCATGAGTCCCTGCAGACGGGCGGA
GATGCGGAGATACCGGCTGCGTGCCAATCACGGAAATGCATGGTCGCAGCCAGTTGACGTCGATGGCCTGTATGCAGAGC
TGCAAGAGGAGGTGCTCGAGAGTCGACGAAACCAGCGGGACCGCGACGCATGGGTGGAAAAACACCTGCGCAACAAGAAC
AGGAGCAAGAAACGAGAAAGGAAGGGCCGTGGCGCAAACAGTGGTGGCAACACGAAGATGGACGTGGATACGGCGCATCC
GGTCGATCCCACGGCTCCGAGTTCTATGGCGTATCCACGAATGCTCTGCCAGCCCAATGATAATGTTCCGTGGTTCGCGC
AGGAATTGCCACAGCGAGTTTTATTACAGGGAGCCCCGCAGGGAGTTCCACAGGGCATGAGACCAGCCGCACAGCCCTTT
CAGGCAATGTGGGCACCCCAACAGGTGTTCCAGGGACCGTATGAACCGTCTCACAACCCCGCAAACCATGCGGCTGGCGG
TGAAATCTCTCAGGCAACAGTCAATGGCAACATGAGCGATGCATGGAACATTCAGGCCAATGCAATGGGTAGATGCGACG
GCCAGTACACAGCACGGGACTGGCCATTTGTGTCAGACTGGACCGTGCAAGAGCAATATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62