GenePrediction:GLEAN_3477 Details

Name: GLEAN_3477
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:281134..282389 (+ strand)
Length: 1256
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:281134..281390 (+ strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_156:281454..281639 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_156:281852..282389 (+ strand)
Length: 538
>GLEAN_3477 class=GenePrediction position=GCSC_156:281134..282389 (+ strand)
ATGACGCTCTCGGCCGAACAGCTTCACGTTTTGGAGATTGTCGAGAGGTGCTGCTCGGGCCTCTCCATCCTCGGCATACT
GATCATCATAATCACATTCTTCTCGTCAAAATACTTCCGGAACCCCATCGACCGCCTCATCCTAATCAATGCAGTTTACA
ACATCTTCGACGTCGCCGCAACCATGATCTCGCTTAGTGGACCTAGTGCAGGGGACCATTCAGCCTTATGCAGGTTCCAG
GGGTTCTTGATGCAAATGTATGTACCTGCCTCTCGTTGATCGGAATGGTATCGTGACGTCACTAACGGCCCTCTTGGCAG
GTTTCCACTAGCAGATGTACTTTGGACGCTTGCAATGGCTTGTGACGTCTTCTTGATTGTGTTTTACCAGTACGATCCCA
AGGCTCTGCGGAAGCTCGAGCTCAAGTACATTGGTGGAATCACCATCATTACATTCATCCCGGCCTTTGTGTTTCTATTC
GTCCACACTGCAGAAAAGGGCCACATGTATGGAAGTGTAACGGTGGGTGATCTTCTTGAAAGCCTGATGGCTACCTTTAT
GATTGGGGCTAATCTTGTCAGCTTTGGTGTGCCATCTCTCCACATTGGGTGATCTTCCGTATAATATTCTACTATGCATT
CATCTGGTATGCCCCAACTATTCCGATACCGAGTTCCGTCTTCTGTTCCGACACCAATAATAGTTTTTGTTTTTACAGGC
TCGCTATATTTATCGCCACGTTACTCTACTGCCTTGTCGGCTGGAAGATAGTCAGCGGAAAGCGCGCGCTCAGGTCCATC
GAAGTCGATCTTGTGCCCCTGGATACTCGCCTTGCCGAAAAGATTTACAAGAATGGCCATGACAGTGGCCACGAGCTGTT
AAGCCTTGGGCCTGACCGCATTTCAAGATCACGCGACGGATCTGAATCGACGTATCAATTGCGTCCGCCCGAAAACTTCA
CTCCAAGCCGCAATTGGCAAGGCAGCCAGTCTGCTCTCTCGTTGAGGCAGTACATCCTTATGCCTGGGCTTTTCCTTGTC
GTATTGCTGGCTATCTGGGTGGCCCCGACAACAAACCGAATTGCGTCTTTCGTCAGACCGGATTACGTATCTTTTCCGCT
TTATATCGCTGTTGGAGCTACGGGCTCACTCCGTGGCTTCTGGAATGGCGTTGTCTTCTTAGCCGTGGGTATGAGGTCAC
GGCAGAGCCAGAAGAACATTGAAGAGAAGATGCACCCGACCCGCCTGGTGTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62