GenePrediction:GLEAN_3478 Details

Name: GLEAN_3478
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:287435..289314 (+ strand)
Length: 1880
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:287435..287902 (+ strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_156:288028..288118 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_156:288168..288957 (+ strand)
Length: 790
Type: CDS
Source: GLEAN
Position: GCSC_156:289011..289314 (+ strand)
Length: 304
>GLEAN_3478 class=GenePrediction position=GCSC_156:287435..289314 (+ strand)
ATGGCGCAGGCAGTAGCAACGGCCGTTTCGCCCGAGCTGCACGGCGTGTCGACGTCTTCACGACCCGTCGAGATGGCAGA
CTTGGAGAAAAACGAGATGGCAGAGGCGGCCAGTCGAGAAACAGAGGGGGCTGAGATCGGAGACAAGAAGACGGCAGACG
GCAGCGACGACGACATGGACGCCGGAGATGATGCCGACCCGAAGACAGTGCTGCCGTTTTCAAAGCTGCGCTGCGTGGCG
CTCGTGGTGACAACAGCCAGCGCCGGTTTCCTCAACATTGTGTCACTGCAGTCGGCAGTGATCATCATGCCTACGATCAG
CCGCGACCTCAACATTCCAGCCAGCCGGCAGCAGTGGGTACTGTCGTCGTACACGCTCGCCTTTGGCTGCTTCCTGCTGA
TCTGGGGCCGGGTGGCTGATCTGTACGGAAAGCGGCCCGTCTTCATTTTGGGCAGTGCCTTTGTGGTGGTCATCACGGCC
ATCAACCCGATTCTGCCCAACGAGATCGCTTTCGACCTGTTTCGAGGCCTACAGGGATTCGTGCGTCTCTCTCTCTCTCT
CTCCCTCTTGTTGAGCCGGATCTGACCTCGCAGGGCGCTGCCGCCAACGTGCCCACGGCCATTGGCATTCTGGGCGTGAC
CTTTCCGCCGGGCAAGGCCAAGAACTATGCGTTCAGCGCGTACGGTGAGTGTAGCCTCCGTCTCTGCCTCTGTCTGTCCC
GCTGACCCTCCAGCTGCCGGTGCTCCTCTGGGCGGCGTCTTTGGCAACGTCCTCTCGGGCCTGGTTGCCAGCTATGCCAG
CTGGAAGTGGGTCTTCTGGGTGATCGCGATTCTGTCGGCGTTTATCACGGTGGCCGGCATCTTTGTCATTCCGGAGCTGC
CGGAAACGCGCACGGCCGAGGAGCTGGCTGAGCTGTCGCTGCTGCATTCGGTCGACTGGATCGGTGGCGCGCTGATTACC
GGCGGCCTGATCGCACTGCTCTTTTCCATGACCGAGGGCAACATTGTCGGCTGGTCGACGGCCTGGGTCATCGTGCTGAT
CCTGCTCGGGCTGCTGATGATCGCCGTCTTCATCGCCTGGGAGCTCTACCAGGAGAAGCATACGACCCGATCACCGCTGA
TCCGGCTCTCGCTCTTCCGCAACCGCCACTTCTCGGCTGCCGTGCTGATCATGTGCATTTTCTTTGGCATCTTCAACGAC
TTCTCCGTCTATGTCACCTACCTCTGGCAGGACTACCAGGGCTACAGCCCCATCCAGACCATGCTGCGCTTTCTTCCCGG
TGCCGTCACCGGCACCACTGTCGCCATCATTGTCGCCCGCCTCATCTCACAAGTCCCCACCGTGCTCATCCTTGTCGCCG
GTCAGCTGGCCACCTGTGTGGCCCTTATCCTGATGGCAGTGCCCCTCCCTGACAGCACCTCGTATTTCGCCTACGGCTTT
TCAGCCATGGTGCTGGCCGTCGTTGGTGCTGACACTGCATGGCCGTGTCTGACTCTCTTCATGTCCAAGAGCTTGCCACC
GGAGTGAGTCGTTTGCCTGCTCTCCCGTCCCTTTCTTTCAGTTGCTAAGTTATCAGACACCAAGCAATGGGTGGCGCTCT
CATCAACGCCTCCGGCCAGATCGGTCGGGCCATCGGTCTCGCCATCACGACAGCCATCCAACTGACCGTCGTGGCCCACG
AACGCGGCGTACCAGTGCAGGATGTGGGTGCCGTCGTCAAGGGCGACCCGGCCTCGCTGCGGGGAATTCGCGTTGCTAAC
TGGTTCAACTTGGCCCTCGGTGGCTGCTGTGTCATCCTTTGTGCTGTGCTATTTCGTGGCACAGGCATTGTTGGCAAGAT
TCCCGTCCAGCGACAGCGACAGGGTGGTGTTTCCGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62