GenePrediction:GLEAN_3479 Details

Name: GLEAN_3479
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:385538..387153 (+ strand)
Length: 1616
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:385538..386291 (+ strand)
Length: 754
Type: CDS
Source: GLEAN
Position: GCSC_156:386357..387153 (+ strand)
Length: 797
>GLEAN_3479 class=GenePrediction position=GCSC_156:385538..387153 (+ strand)
ATGCCACCGATATTACGGACAACGCCGAGTTTCGTGTACAAGATACAGGGGCATCGGCTCGCCGCATACAGCAGCAGCAA
CAAAGACGCCGTTAAAATGAAGAACGACAAGATGAATACAAATATCCAAACTGCACAACAACACTTGCAGACAGTGTACT
TGGCTTGCCGGACCATATTCTCGGGGCCCCATGCGAACATCCGAAACCGCCGTACTGTTGCCAAACATCTCACGCCGGCC
AAGGCAACTTCCCATCCTCTGCTTAAAGGCATGGATGCTACCGCTCTTACCGATTCCGCTGAAAGCCTCCTACGTCAAGG
AGTGTTTGCAGACGAAACCTTAGCCAAGAACATGTTCCCAGACGTTTTCGAGGCAGCAGCTTCTGTCTCTCCAGGTGACA
AAACCGCTTCTGTTGACACTATGGCCTCTTCACACAAAGTCCAATCTGCCGGTAGAGGTGGGCAGATCAAAACGAGAGAA
AAGACAACAAATATAAAAGCACAAGAGGTAGATGAAAAAATTGGCAAGCTTGCTGTCATGGGTGCTCTTCCTACGCCGGC
AAAGCCTTCAGCCGGAAAACTAGAAGAAACTACTGTCAAGTTCACCACTCTGGCGGGAAACGACGAGGGAACAGGGAACA
GAGTGGTCGCAGGAAAGCCTCAATTGTCTTCTACTACTGGCATTAAGGCTACTGCCATGCAGGTAGCCACCCAGGTCTCA
CTTAACAGTATTGATGATAGCCAGAGCGTCAACAGTGAGTATCTTCCTATTTTTATACACCTTAGCCATCGACACGTACA
TACCTAACAAATTTGATAGGGTCCACATCCCAGAGAAAGTCCCTGGTTGAGAAGTACCCGACGTTAGCCACAGGGACGTT
TCCCTACCAAGCCCAGCATGCCGTTCTAACACGGACCCAGCAGCTGCTCGAGGATTGCTTCTACGATTTTGCTAGGAAAC
ATTTTCCTGATCTTATGAAAGCCAGGAACTGGGACAGCGCAGCCTGCGTCGAACTTTCGGAATGCACCAAGATTTTCCAG
AAGCCGGGCCAGGAGCGCTCCAAGCTACGCAATACGGACGAAGTGGCAGATGGGGAGCAACTAGACGAGGTCCTCCACGC
TATGAACACAATCCGTAACTCGACCGTTCACCGGAACCTTCACCCAGCACGAGGCCTGAGCTGGCTCATGAAAAAAGCTG
TTCAATTTACTGAGATTACACAGGACAATGCCCGGGCTGAACGGCTGGTGGAGGTTCACACCGTGGTGGAAGATCTCTTG
ACTCAAATGGAAACTAGAGAGAACGAACTAGACGCCTGGATGTCAGGGGCGATGCATGAGATCCAGGAGAAGCGCGGATG
GCTCGATACCATGGAGGCAGATCTGTGGCGGCAAATGCACGCACGGGACAAAAAGAGCCGGCATTACACCCAGGAGTGCC
TGAAAGCTGCAGCCTTGGACATCTTTGAGAAGCCTATGAAAAAGATAGAGCAAGTGAAGGGACAAGAAGCTTCAGTGACA
GCCCATCACAAGATTTCTCGGGCCCAAGAACAGACTCCGGTCAATAAGCCATGGTCGCTGGTGAACTTTTTGCGCAGCAA
GAATCCTTTTCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62