GenePrediction:GLEAN_347 Details

Name: GLEAN_347
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1183274..1183799 (+ strand)
Length: 526
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1183274..1183389 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_167:1183541..1183799 (+ strand)
Length: 259
>GLEAN_347 class=GenePrediction position=GCSC_167:1183274..1183799 (+ strand)
ATGTCGTATATCAGCGCCGCCCCCTTTATCCGCAAGCGGCCCTGGCTGCTCAATGCGTTGAAGCCGCTTGCCAACTGGTA
CATCAACCTGGCCGGATACCGCCAGATGGGCTTGAGGTAGGTTGGAACTCCAAGGGAGCTTCACGGTGCAGAGGGCTCTC
AGACATTGCAGTCCGAGAGGGGCAGAGTAATGGTTCAAAGCGTCAAAGAGGAGGCAACGACGTGCATCCACCGCTCGAAC
TCGCAGACTAACTATTCGCGTTCGCAGATCCGACGATCTCATCCCCGAGGAGAGCGCAGTGGTGCAGCAGGCCATTGGCC
GCCTGTCGGCGCAGGTCAAGTACGACCGCGTGTTCCGGATGCGCCGCGCCACGCAGCTGAGCTTGCAGCACAAGCTGCTG
CCTAAGGCACAATGGACAAAGCCTGAGGAGGACACGCCGTACCTGCTACCGATTATCAAGCAGGTCGAGGCGGAGATTAA
GGAGCAGCATGAGCTGGACTCGATCGTGGTGATCAAGAGCCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62