GenePrediction:GLEAN_3481 Details

Name: GLEAN_3481
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:392632..394134 (+ strand)
Length: 1503
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:392632..392719 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_156:392776..392861 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_156:392919..393086 (+ strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_156:393136..393241 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_156:393295..393421 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_156:393473..393614 (+ strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_156:393668..393818 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_156:393875..394134 (+ strand)
Length: 260
>GLEAN_3481 class=GenePrediction position=GCSC_156:392632..394134 (+ strand)
ATGACTCTCTCCCATCTCGGCTGGCTGCTCCTCGGAGCGGTTGCAGCAGCCCAGAATGTCGGGCCTAACTACCAGTATGC
TCTTGAAGGTCTGTGTATATCCACTATCCTCACCGGGACATCAGCTCACCATGTTATCCAACAGACCTTGATAAGGACTT
GCCCTTCTCACAGCCCGTGACTTTTGCCCATCTTGAGTGGCAGCGGTGTCTTTCTGCCTCCCACAACAAGGTAGACCGTT
ATTGTCGGCCCTCTCAACCGTCTTATGAGATCTAACACCGCAATCAGCCCCTGGATGTTGCCATTTTGGGATTTCCATAC
GACACGTCGACGTCTTATCGGCCAGGTGCCCGCTTTGGCCCACGAGGCATTCGTGCTGGTTCCTCGCGGGAGAAGAAGGG
TCGTAGCTACAATACTGTTTGGCAAGTAGATCCGTATGAGCAAGGCCTGGAAATTGTAAGTGAAAGAGGAGCTTGATAGA
GTGTGTGCGTAACTGACCACCCAGATCGACTGTGGCGACGTGCCCATCACCCCCTTTGATGCCGCGCATGCATTCAAGCA
GATGGAGCAGGCTTATCGCCAAATTCTCTATCATCCGACATCTGAGCAGAGTGAGTGAGCTTACTTTTGTCGTTCACCTT
CTCTTCCGTGCTGACTCTTGTAGACGGCTGGGAAAACCCTCGCATTATCAGCCTCGGAGGCGACCATTCCATCGTACTAC
CCATTTTACGTAGCCTAAAGACTGTATATGGCCCTATCTCGGTTATCCATCTCGACTCGCACCTGGACACGTAAGCCGTT
GCTCCAGTGGAAGATCAGATGGAATGCTGACTCATCCACAGCTGGGACCCATATGAGGGCTACACCGGCATCGTGTCGAA
CCAGTCTGCCATCACCCATGGCACCTTCTTCTGGCACGCCAGTCGAGAAGGTTGCATCAGCAAGGGAACAAGCGTTCATG
GAGGCTTGCGAACTAAGCTTTTTGTAAACCCCCGAGTTTTTGTCCGCTTCATCACTCTTCTTCTGACTTTCCTTAGAGTC
CTAAAGACTACAAGATTGACTCGGAGGTCGTCGGCTTCACGCTCATCGAGGCTCACGAGATCGACGACATTGGCGTTACC
GGAATCGTCAAGAAGATCAGAAAGGCTGTCGGCGATACGCCCACCTATCTCTCCATCGACATTGATGGTAAGCATCCTTC
CTTGCAATTGGTAAGAGGTTGCCCATACGCTGACACGCACCAGTTCTCGATCCCAGCATTGCTCCCGCCACCGGAACACC
CGAGTCTGGGGGTTGGACCACACGCGAGCTGAAGCGTCTGCTCAAGGGCCTCGAAGGCATCAACCTTGTCGGGGCAGACG
TGGTTGAGGTCAGTCCACCGTACGACTCTGTGGCTGAGACAACGTCCATTGCGGCGGCCGACCTCATCGTTGACATCTTG
GCCGGTATGACAAAACAGGCTTCGTTTGCGGGCAAGCGAGTCATCCCAAAGGATGAATTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62