GenePrediction:GLEAN_3484 Details

Name: GLEAN_3484
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:417476..421388 (+ strand)
Length: 3913
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:417476..419573 (+ strand)
Length: 2098
Type: CDS
Source: GLEAN
Position: GCSC_156:419648..419689 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_156:419788..419889 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_156:419955..420014 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_156:420176..420331 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_156:420388..421388 (+ strand)
Length: 1001
>GLEAN_3484 class=GenePrediction position=GCSC_156:417476..421388 (+ strand)
ATGCCGACAGTGGCCCCGGACTCTAGTACTGCTGCAATCACAGCACCACAATCAGACGCGAATATTGGCGCATCTGACCA
GATGACTACCCTCACGGTGCCTGAAACAAATCTAGAAGATTGTGAGAATGTCGCAGCTCTTCAAGCGGGAAATGCAAAGC
AAATCCAGTTGGAGTCTGAGGTGCATGACCTGAAAGCCACGATATTGGCGCTGGTCAAGAAACAAGAAGAGTTGGCGGCA
CGTGAAGCTGAGTTCAGAGAGCCTTTTATACTATCCGACGAGCATCGGCTGGCTCTACAGCATCGCCGTTACAATCCCGA
CTCGGATGACTCGGATGACGATGACTACGTTCAATTTGACCATCGCAGGAGGCATATGGAGCGTGTTTATATGCGGGAGC
TGAAAACGCTGAAGAGAGAAAAGGAAATGATCAAAAATATTCGGGAACTTCGGAGAGATAGGGACACACTCCTCGGAAAA
GAGCAAGCTTGGGAGAAAGAGCGCCTCGACATGATGAATAGACAAAAGCACCAGTCGCGGGAAAGCAATCAACCGGATGA
AAATACACAGGACGATAATGCGCAGGCATCTGAGAGAAGCGCTCATATTGAGACAAATGATGAGACGGGAATAGCCGAAG
CAATCCTCCCAGACCCTACGGAAACAGCAGAGCCCAAGCTCAATTATGTCGAGTGGTCAAGATTCTCCGTGCTCAGATCT
ATCCCGGAGAGAAGTTCGTTTGCTATCGATGTATTAGTGGGCGAACCCATAATTCAATTTGCATGGACAGGCTACTATGG
GTCAAATAACTCGAAACGAGGCCGTGCGAAGGAGGATGGGACAGCTGCTTCCAAAAGTGTGAAAGAAAAGTTGCCTGGAC
AGGGACCTCTGCCCGAACGCATCCGAATCCACTCCACTCCAATTCTCAAGATTCTCGAAACGATAAGCGGGAAAAGTCTT
ACCTTGGATGATGATACTGTCGTTATGGTCCGGCCATTCAAGTTTCTGGTATACTACAAGGATCAGATACGGCACAAATT
CCAAAGCCTCACAGAAAAGTTCGCCGGTGAAGTAGGCATTGTCGGAGATGGTGTTGCTTTTACTCCTTTGCCAGAAACCC
CGAGCGGAACCAGATCGAATAGTCTCGACAAGAATGCTGAACAGCCGAGCACGGCTTTGCCAGAAGTAAGCTTCGATGAG
GCTGCCAAAGACGATGATGACGAAGATGAGAGCACGACATCGATTACTGCTCTTCGTGCTCTAGGGTGTTTGGTTGAATT
CATCGACTCTGAGATCCAACCAAAGTTGGATTATCTGGAAAGTGACAATTGCACGAGGGTTTCTTTCACGGACATCTGGT
ACTTGTTCAAGCCTGGAGACGAAGTTGTTGACCAAGGCCGTAAGCAGGCCTACAGAGTGATTGAGGTGGCCAGCGTGAGC
CACAAAGCGATCTCGCCCTGGCGCAACTATGACAAAGAGGCGGCAAAATCTGACCAAATCCCTGTTCGTCTCCACTGTGT
ACATGTGGACTTTGATGGCAAGAATATCGGCCCTGTGAGCGAAGTTTTTGAAATTCCAAGGTTCGATGGAGAAATGGCCA
TTACATCGCTTGATGTCTATCCTCTGCGGTACTTGAAAGAGAGCGGAGTGTTCCGAGAACAGCTTATTTCCAGGGGGAAA
ATGTTCTTAGATGTGGCAGGCATCAGGCACATGCACTACAATGGACTAACGTTAGTTGCAAGGGAAGAGGTGGACAGCCA
AGTGGTGATTGACTTTGAGGAAGCATTTGCATCGAAAGATTACAGCAAGCTGAGGCCAAATATCGAAGAGTTGATCGGAA
ATTCACAGCTAGAAGGAGAAGGAGACGAATCATGCCAGTTTGAATGTTGCCAAGATGAGAATATCCACAAAGACAAAGAC
ACGGACATGAAACATAGCCAGGACTATGTTGCTAGTCTGATACCAGAAGGTCGAAACAAGCTCCCTTCACTGGCATTATA
CCCTCGTGCGTTGACGGATGAGACTGCATTAACCGAGGATGAGCTTGTCATAATATCCTATCGTGTCTTTGGCTTCGTGC
TGCGAAGCAGGAAATGGGGTAAGCTTACACTCATCACTGCTTCTGCCCCCAAAAATGGAATGGTTGTAACTGACTTGAAA
CTCGTGACCTAGCCACACTAGATCTCACACATCTTAGTCCAGTCAACTCTGGCGGTAGGTTGGCGAATGCCGTTGGACTT
CAGGGTGGGGACAGTCTAGAAAAGCCGAGCGAAAAACAAGAGAGACGGCCTTTGACCAACTTGTATTGCCAGAGGGCCAC
AAGAAGATGGTTCTGTCTCTGGTAGCCCAGCATTTCCGGAATAAGGAGTCCTCTACGGCCGATACAGAGCAGGTTGATAT
TGTCCGCGGTAAAGGTATATCGGCCTCAAATCACCATTTCGCTTATATGATCCAGCTGTGTTTGCTGATAGTATTTTAGG
CAAGGGTCTGATCCTCCTTCTCCACGGAGCTCCTGGTGTCGGAAAAACAACAACAGCCGGTGCGTATTGCACCCTCTTCA
ACTTTCTGTTTGGCTACATATTGACCACGGCTTCCAGAGGGGGTAGCTGAGCTGTTCAGAAAACCTCTATTCCAGATAAC
ATGCGGTTCGTTCAATCTTGCCGACTGTTTCCTGATCACGACTGATACGATGACCTCTAGGAGACTTAGGAGCAACAGCA
AATGAAGTCGAGCTTGCGCTTGAGACAAACTTTGCTTTGGCCAATAGATGGGGTTGCATTCTTCTGCTCGATGAAGCTGA
TGTCTTCCTCACGGCACGAGCGCCGCAAGACTTTACCCGCAACGGTCTAGTAGCAGGTTCGATACATACCTCCCGTCTAA
TAGACGCAGATGTAGCGAGCTAACGCAAACAGTGTTCCTCCGTGTATTGGAGTACTATGCGGGCGTCCTGTTCCTTACTA
CAAATCGGATCGGCGACTTTGATGAGGCCTTTGTATCACGGGTTCATATCAGCCTGTTCTACCCTCAGCTCGATCTGAAG
TCCACACAAGACATCTTCAAGCTCAACCTGAAGCTGATCGAGAAACGCTTCAGGCAAAACGAGCGCATCATCCGTATTGA
CCACGACAGCATACTCCAGTACTCGGAGAATTACTGGAAGGAGTACGAAAAGATGCGATGGAATGGACGCCAAATTCGAA
ACGGCTGCCAGACTGCTTTGGCGCTTGCAGAATTCGACGCCCAAGGCGGTAGCTACGAGCGCATCAAAGACGCCAATGCC
GAGGTCAAACTACAGGTTGAGCATTTGAAGACGGTTTCCTTGGCATACCTGGACTTCAGTACCTATCTAAAGGATATTTA
CGGCAAAGATGCTGATCGAAGGGCAAAAGCCATTGGAATTCGCGCAAGATACGCCGATACCCACTCGATGCAGCCAGAGC
TGAGCACAGCTGCAAGGCCATCGAACACACCTTCCTCTACCGTAAATCAAACGTATACGCCTGGATCGGGTGTTCATCCG
GCACATTCCTCCATCTCGACAGCGCAAATTCCCTCCCAGTTCTACTATGCACAACAAGTTGCTGCAATGCAACAAGCTTC
GCAACAACCCCCAAATGCGTACGCGCAGTTGCCAGGTCAGACTTTCTGGAACAATCAAAACATAGGCGCCACCCCGTTGC
AAGATGGTCAGCAACCCGTGTCGGTACAAAGTCAGTACAGTGCATATCTGCATCCGCAGCCGCAGCTGCATGGGATGCAA
GGCAGCCAGTCACCCATACCAGGACAAGGCCAGTTTGCTTCCTACCCAACGGGGATGCCGGCTACTGGATATCTTCCTCC
ACATGCCTCTCAGGCAAGCCAGCAGCAACAGGTGCCAGGGGGCGTCATGCCACCACCGGGGAATCAAGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62