GenePrediction:GLEAN_3486 Details

Name: GLEAN_3486
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:430473..435478 (+ strand)
Length: 5006
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:430473..430502 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_156:430558..431824 (+ strand)
Length: 1267
Type: CDS
Source: GLEAN
Position: GCSC_156:431911..432970 (+ strand)
Length: 1060
Type: CDS
Source: GLEAN
Position: GCSC_156:433358..433831 (+ strand)
Length: 474
Type: CDS
Source: GLEAN
Position: GCSC_156:433891..435478 (+ strand)
Length: 1588
>GLEAN_3486 class=GenePrediction position=GCSC_156:430473..435478 (+ strand)
ATGGACGATATAGAATTCCAGAGCTCTGAGGTAAGACGTCTAGTATTCCTTTTAAAGTATACCCCCTGCTTAGAATCAAC
ACCAGGTCCGATGCACTCTGTTTTCTGCCACGCGTGGACTGCCCTTTAAAAAGGGAGACTGGCTTCCTGTGCCCTTGCCA
CCGTCGAACTACGATGAAATAGCTGACCATACATACGACGTTCACGCCCTCCTGCACGGCATAAAGCGCTGCTCGGTGCG
AGAGCTTGTGTCAATATTGGTGCTCGCTGATATCCTCAAGATCGATAGCAGCTCATCGATGAAACAGCGGGTGGTAGCGT
TTCTCGCCCATCTTGCCATTTTGAAGCACTGCTCGCTCTCGAACCGCCCGGTGCATCCTGGTGTGGCACGCAGCAATGAA
GAGTTGTCCTTTCTCAAAGTGTACTGCGAGCTCTCACGGAAGGTCTTGGGAGAACGCCCATGGGAGGTGGCCGTGGGTTC
CACCTCGACCTCCGTAGTTTGGGATGCATACGATCTCGTGGACGGGCGGCTGTGGTTGGCAGTTCTGGAAGGTCAATCCA
GCGTCACAAGCGAGACCAAGATGGCTTCCGACTTTCGTGACCTGACCACACGTCTTTCGGCACTCTGTGGCTTCGACCTG
CAGGATTGTCTGCCTGGTTATCTCAGTACATCCTCCTCACCGACAACTGAAGCTCTCACAGTGCCTTCTACCATCATCAC
TGGCTCCATCCTTCCGTTTCAGCACCCAGACTTTGATGATTTTTTGGGCGATGTGGCCGTGCCTGTAGACTGGGATGCTG
AACAAACTCTGGCTAGCAGCCATAATTCGACTCAAGTCTCACAAGAAGAGACACATTGGCACAATACCAAGAAGCTGGCA
GCAACAACGATAAACAAACCGGACCCTAGGAAAATGTTTTATTTCAACCGCCGCAACCAGCGTTTCATGACACAGATTCG
AGACTATGCTGCCAGCTTGACTAATGCAACGGGCAAGATTCTCGACCGCGAGACCATCGTCACGGCGGTACCACCCAAAA
AGCTACAGACAGTAGTTCAAAAGAGTTTCAAGGGCAAATCTAGAGAAAGAAAGGCTGTGACCAGCAACAAGAATGTGGCA
CAAGAATACCAAAAAGCCAAGCAAGTTCCGAACATTGTCATGAGATGGCGCTCGGCCTACGAGAATCTGCAGAAGGAAAA
AGATACTCTCAAGCAGTATGAAGCAGCCGTGAAGTACTTTCAGAACTTGTCTCCGCTGAGTCGCGACATTGTCGGTGCCG
ACGTGGTGCTCCACGTCTGCAACATCCTCGGCAAATGCCTGTGCGATAGCAGCAGCAAGCTAAAAATGATCGGTGAGGAA
ACCTCCGCGTGTTTTGTCTGGGATAGTGAAGAGCACATACATATCGTTGACGCGTTATACTAGCTCCCAATATAGCAGCG
CTCATATGGGCACAGATTCAGGAGCTGAGCCGACTGCCACTGTCTGCCGAGGCTGTGCAGATCGCCCAGGACCTGTGCAA
GGCGGTGATGATTCCAGTCGGGCCACTTTCCGTTCGCACAGATGGTCTCATCACTCCCCTCGAATCGCGGTCTGCAACAG
TGCGTGTGATAAGCACGCTCGAGAGGGCAAAAGACGATGCGCGTCTAGTGACTCGGCCGGCCGCTTTCCAGCTCGGAGTC
TGTGGGCCATATCTAGAGCGAGGCTTTGACTCGCAGCCGGATGCGCGCGTGCTGAACTTTGAGCCGGATGGATGGCAGCG
CAAGGTTCTGGATGCGATCGATGAGCGGCAGAGCTTGTTTGTGGTGGCGCCAACATCGGCAGGCAAGACCTTTATCTCGT
TCTACGCCATGAAGCAGGTGCTGAAACAGAGCAATGACGGCGTTCTCGTCTATGTGGCCCCAACGAAAGCGCTGGTCAAC
CAAGTCGCTGCCGAGATCGAGGCGCGCTTTTCCAAGACGTTCCCACAGAGCAGCAGTGGTGGAAAGTCGGTATGGGCCAT
CAAAACACGTGACCAGTGCATCAACAACCCGACAGGTTGCCAGGTTCTGGTGACGGTACCGCACATGCTGCAGATCCTAC
TAATGTCACCTAGCAGCATGGAGGGTAGTAATCCGTGGCCTCTGCGGCTGCGCTGGATCATTTTTGACGAAATACACAGC
ATTGGACAGTCCGACGAGGGAGTCGTGTGGGAACAGCTCGTGCTGATGGCACCCTGTCCCATCATTGCGCTGTCGGCTAC
CGTTGGAAACCCCTATGCGTTCCGGGACTGGCTCACTAGCTGTGAGAAGTCCAAAGGCCGCCAGATACGCATGATCACGC
ACTCTTCGCGGTACTCGGACCTACGCAACTACGTCTGGATGCCGTCGAGACATTTTCAATTTTCCGGCGTTACGGCTGAA
GACAGCCGTCGATGGCCGATTCCTGGCTTAGAAGCTGATGGCTATAACGAGAAAACGCCATTTATGGTTGTGCATCCGGT
GGCGAGTCTGATAGATCGGTATCTTTATGCTTTCTTATTCATATATTTTGTACTTTGTAATACTAACTACTGTAATAGAA
GCAGGGATTCTTTAGACGACATAAGCCTCGAGCCACGCGACTCTGTGCTTTTGTGGCGCAGCTTAAAAAGGCACCACACC
GCAGATTTTCCGCTTGACCCTTCGCTTAACCCGGACGTTTTCTTCTCTTCTAAGCTATCGGTAACCAAGGAACACGCCGT
GGCCTGGGAAGTTCAGCTAAAGAAGGTGTTGCTGTCTTGGATGCATGACCATCGCTCGCCCTTTCCAGCAGTGCATAAAG
ACCTTAGTCCGATAGGCCTCCGAAGAAATTCAGGAGGTTACCATATTTCAAGTAAGCTCTTAGAGCTGTTGACTGACCTG
CGCAGACATGGAGCCGTGCCGGCACTGCTGTTTCTGTACGACCGCAAGCTTTGCGAATATTCGGTGTGGCACATAGTGGA
AGGGCTTGTGAGCGCTGAGAAGGCGTGGAAGAAAAACAGCACTGAATGGAAGCAAACCATGGCAAGCTTCGAGAAGCATC
AAAAGGCCAAGACAGCAAAGAAGGCGCCAAAAATATCCCGCAGTACAAAGGGGAAAAAAAACGACGATGACGGCAACATA
TCCAAATTTGAAAGCATGCGCGAGGCTGCCAACCAGGAAGTCAGCAAGTGGGACTTGTTCGACCCAAACGCACCGCTAGC
AGAGTTCAGCCTAGCGAACCACACAAGGCTTCCTGCGTCGGAACTGGAGAAGATTATCAAAAGCCTCGACGGTGCCGGCA
TAAGGCCCTTTTTTATCGAAGGACTCCGCCGCGGTGTCGGTGTGCACCATGCTGGGATGAGCCGTCGATATAGACAGATG
TGGGTTTCCATTTGCTTGATATACCGCCCTGTCACATTCTTTTCTAATCCGATTCTAGTGTCGAAATGCTCTTCCGCAAA
GGCTTTCTAACCGCCGTCGTGGCCACCGGAACACTGGCTCTAGGCATCAACATGCCATGCAAGACAGTCGTCTTTGTTGG
CGACTCAACCTATCTGAATGCCCTCAATTATCGCCAGGCCTCTGGCCGTGCTGGTCGCCGCGGCTTTGATACCCTAGGCA
ACGTCGTCTTCTATGGCTTTACGCCCCAGCGCGTCATGGAGGTGTTGTCGTCGCGGCTGCCCGATCTCCGTGGCCACTTC
CCGCTCTCAACGTCGCTAATCCTGCGCACATGCATGTTGCTGCACCAGACGGACCGCTGTTCTTTTGCCCGCGACTGCAT
CGTGCGCTCGCTCTTTTCGCAGACACGCATGTACATGGGCGGACCGGCTGGACAAGACGCCATCAAGCACCACCTGCGCT
TTTCTATCGAGTATCTGCGCCGTAACCATATGCTCTCGGTTCGTGGAGTGCCCCTCAATTTTGCCGGCCTCGTCGGCCAC
CTCTACTACACCGAGAACAGCGCGTTTGCCTTTCACGCACTGCTGCAGGAGGGCTACTTTCACCGGCTGTGTGCTGGATT
TTCCGGGAGGGCCTCCAACACAGACGAAGTGATGCGAACCATGGTCCTCGTGCTGTCCCACCTCTTCTGTCGACGGCTCT
GTCGCCGTTACCAGGACCAGACATGGCTGGCGACCGTGGTCAAGCCGTCGTCGTCCATTGTCCTCCTGCCACTGCTGCCA
TCGGATGCCTCTGCGATCCTGCGGGCGAACAACGCGAAGACGCGGACCATCTTCCAGACATACGTCCAAAGCTACGTGCG
CCAACATCTGGCCGACCAGCCCGACCGATCCCTGCCACTGACAGGTATCCTCGTGGGACCGCAAGGTGACCACAGCAGCA
GTGGAGGCGTGCAGCTGCGGTCGCCCTTTGCTGCACTGTCGGGCTTTACCGACGACTTTCAGTCGGTGCACGACCTCTGC
GAGACCGTGCGCGCCGGTGTCTTCCTGCAAGAGGCGTCTGTGCCGTACCTTCCTGTGTCCCCAGATGATACCGACGGCGT
GCCTCTTAACGCATACATCTACGACTTCTTCCGTCACGGTGACCTGAGTGCGCTGAAAAATGGCAACGGCATCAGAGAAG
GCGATGTGTGGTTTTTGCTGCAGGAATTCAGCATGATTCTGGCCACCATCGTCACCAGTCTGACCCTATTTCTGGAACCG
GATGCGGTGGCATTGGATGATTTGGGAGTGGATGAGGATATGTGGGACGAGGAAGATGAGCAGGACGAGCAGGACATGGA
TTATGAGGGCGAGAACGTCCAAAAGATGTCTACTGCGGACACTGGTACCGCGGCCGTCGCACGTCTACACAAGGAGAAGC
GGAAGAAGGAAAAGGTGGCCGATTCCTGGGAGGATGAGACGGATTCAGATTCATCCACCTCGACCACTACGACAAAATCA
GCAACGGTCATCTCCACAAGCAGACCCAAAGACAATGAAAGCCAGATGCGTCTCCGGAATGTGCTTTCGGCCTTTAAACA
GCTGAAGGCGCAGTTTGATGTGAAATTTCGCAAGGTCTGGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62