GenePrediction:GLEAN_3488 Details

Name: GLEAN_3488
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:451897..452779 (+ strand)
Length: 883
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:451897..452440 (+ strand)
Length: 544
Type: CDS
Source: GLEAN
Position: GCSC_156:452511..452779 (+ strand)
Length: 269
>GLEAN_3488 class=GenePrediction position=GCSC_156:451897..452779 (+ strand)
ATGATGGCCGGTCTTTTGTCCCTGGTGCAGGAGCTGCTGCCCATGATCATCCCGGGGTCTGTGGAGATCACCAGGGCCGA
GGAGATCCGGCCGGCCTCACCGTTGACCGATGACGACGAACCGACGACGGAGCCGACCGGTGCCGAGAAAGCTGGCGATG
TCGTCGTTGCCGGAGAGGAGGAGGATGCATCGGTATTGGGGAGAAGCAGCAGCCAGCCAAACACGCCGGGCCCGGGCATA
GAACCGATAGAACCGACAGCTGATAGCACCGCCCGAGAGAGCCGCATCGACGGCAGCTTGCCAGAACGGCCTCCCAGCAG
AACCACGACAGAAAAGGACAATCTCCACGATGTTCCAGGCAGACCGGAAGGGCCACAGCAGCCGTCAACGTCCAATCCCC
TCCCTCCCACAGTCTCGCCCCGTCGCCGCCGCACTGGCGTCTCCATGCGCGACGCCATGGTCCACAAGTCCGACCGCATG
TGTGCTGTTGTCCTGACAGTGAAACCGCTGTGTTCTACTGTCGTTTTCCACAACGCAGAACAAGGTACGTGTTCTCAGTC
ACCCCTTCTCGCTTCCGTCCTCTCCTCTTCTTCATCGCTGACTTCCACCTGCAGAGTCCATCGTCTACGCTGTCGCTGGC
ACCGCCGTCCTATCGACACTTTCCGAAGACCATGACGCTCACGACGACAGCGACTCGACTGTACCGCCTCCACCTCCAGC
CCGTCACGTGCTTGGCCCCGGAGACTTTGCCTTTATACCTGCTTGGGTCGAACACCAGGTATCCAACGAGAGCCCCGACA
CAGACGTCGTCTGGGTGGTTGTCCGCACAGGTCCTGAGCCTACAGTCGTGCCGTTGTCCGAATGGGGTGGTCCTGAAGCC
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62