GenePrediction:GLEAN_3489 Details

Name: GLEAN_3489
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:459363..463193 (+ strand)
Length: 3831
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:459363..459502 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_156:459564..462591 (+ strand)
Length: 3028
Type: CDS
Source: GLEAN
Position: GCSC_156:462664..462997 (+ strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_156:463186..463193 (+ strand)
Length: 8
>GLEAN_3489 class=GenePrediction position=GCSC_156:459363..463193 (+ strand)
ATGCCGGGCCTCATCACGGCTACCGGCGTTCTCGGCTTTTTGTCCGATGAAGAGCCGGAGCTCAAGGTGTTTGCCTTGAA
CACGCTAAACGATGACATCGACACCGTCTGGACGGAGGTCGCAGGCGCTGTCAGCCAGATGTACGTCTTTCTTTCGCAGC
CTGATTCGGCTTTCTTCTGCTCTGACACAGTCTGTCCCCAGCGAGTCCCTCTACGAGGATGAGCAGTTCCCCGAGCGCCA
GCTGGCCGCTCTGGTCCTTGCCAAGGTGTACTACCACCTCCAGGCTTACAACGAGAGCATGTCGTTTGCCCTGGCTGCTG
GGGACCTTTTCAAGCTCGACGACCCCAGCGAGTTCGAAGAGACGATCATTTCCAAGTGCATCGACCGCTACATTGCCACG
TCAGTGGCCAACCACCAGCCAGCCCTCGACGTCCGCGCGAGCGTGACTCTGCCCTCAGTCGAGACCGGCTTCGGTGCGGC
CGGCGGCGACGGCTCGACCCTCATGTCGCCGACGACGCCCTTCTCCCAGTCGACCCTGCCGTCCAAGTCGCTCCTCTCGC
GCGACTCGGTCGATAACACCATTTTGGACCCGTCCTTCCCGTCGGCCGAGACGAAGGAAGGCCGCTCCGGCTCCATCGTG
CCGCTCGCCGACCAGGCGACCAAGAAGGCCCTAGACCACATCATCGAGCGCATCTTTGCCAACTGCCTAAAGGAAGGCCG
GTACCGTCAGGTGGTTGGCATTGCCGTGGAAGCCAAGAACCTCGAGGTGCTCAGCCGTGTTATTAAGCGTGCCAGCGAGG
ACGCCAAGAGCGGCAAGGGCAAGGCGGTGCACGAAAACGGCCAGGACGCGGCCGACGAGCTGATGGAGTACGTGCTCGGC
ATCTGCATGGACGTCGTGCAGGAGCGCGGCTTCCGCACGGAGATCCTGCAGCTGATCCTCTTCCTGCTCAACGACATTGC
GCACCCAGATTACTTTGCCATTGCCAAGTGCGTTGTGTATCTCAACGCGGACCTGGAGGCGTCTGACCTGCTCCGTAAGC
TGGTGGAGGAAGACGACCTGGAGCTCCGGGTGATTGCATACCAGATTGCCTTTGACATGTACGACAACGGAACGCAGGAG
TTCCTGGGCAAGGTGATGAGCGACCTGCCGCGGCGGGCGCCCAAGTCGGACAAGGCCAAGACAGACGAGGCCAAGCCGAA
GAGCGGGGAGACGGAAGTGGAGGAGGGCGAGTCAGATCCTCTGCTGAACGAGGAGGCGGACGAGCAGACGGCGGCCCAGA
CGGAAGAAGCGGAAAAGTCGGCGGAGAACATTGCGGTGGCATACGACAACATCCGCAGCATCCTGGATGGCAGCACCACG
ATCCGGCTCAACGTCGAGTTCCTCTTCCGCAACAACCGGGCTGACATCAGCATCCTCAACAAGGTGCGCGACAGCCTGGA
GGGCCGCAACTCCATCTTCCACACGGCGTTGACGCTCTGCAACGCATTCATGCACGCGGGCACGACGCACGACAAGTTCT
TCCGTGACAATCTGGAGTGGCTGGGCAAGGCGATCAACTGGTCCAAGTTCACGGCAACGGCGGCGCTGGGCGTGATCCAC
CGCGGCAACATCACGCAGGCACGAAAGCTGCTGGAGCCATACATGCCGCGACAGGGCACGCTGCAGCAAGGGTCGCCGTT
CAGCCAGGGCGGAGCGCTGTATGCGTTTGGGCTGATCCACGCGAACCACGGGTCCGATGCGCTGGACTACCTGCGCAACG
TGTTCGGATCGGCCGAGGATGAGGTGATCCAGCACGGCGGAGCGCTGGGGTTGGGCATTGCGGGCATGGCGACGGGCGAC
GAAGAGATCTTTGAGATGCTCAAGACGGTGCTTCTGGGCGACTCGGCACTGAACGGCGAGGCGGTCGGGCTAGCGATGGG
CCTGATCATGCTGGGGACGGGCAACGCGGCGGCGCTGCAGGCCATGTTTGCATACAGTCACGAGACGTCACACGAGAAGA
TCATCCGGGGCTGCGCGCTGGGAATGGCGTTGATCATGTACGGGCAGCAGGAGGGAGCGGACGGGATGATCGAAGCGCTG
CTCAACGACCCGGATCCAGCGCTGCGGTACGGCGGAATCCTGACGGTGGCGCTGGCATACTGCGGGACGAGCAGCAACAA
GGCAGTGCGCAAGCTGCTGCATGTGGCGGTCAGCGACGTGAGCGACGACGTGCGGCGGATCGCGGTGATGAGCCTGGGTT
TCATCCTGTTCCGCAAGCCGGAGAGCGTGCCGCGGATGGTGGAGCTGCTGTCGGAGTCGTACAACCCTCACGTGCGATAC
GGATCGGCGATGGCGCTGGGAATCTCGTGTGCAGGCACAGGACTGTACGAGGCAATCGACCTGTTGGAGCCGATGATGAA
GGACCCGACAGACTTTGTGCGGCAGGGCGCGCTGGTGGCGCTGTCGATGATCCTGGTGCAGCAGACGGAGGCGCTGAACC
CGAAGGTGACCGCGATCCGGAAGACGCTGAAGAAGGTGGTGGGCGACCGACACGAGGATGCGATGACCAAGTTTGGCGCG
GCGCTGGCGCTGGGGATCCTGGACGCGGGCGGCCGCAACTGCACGATCGGACTGCAGACCCAGACGGGCAATCCGAACAT
GGCGGGCGTTGTGGGCATGGCAGTGTTCACGCAGTACTGGTACTGGTTCCCGTTCACGCACTTTTTGTCGCTGAGCTTCA
GCCCGACGTCGGTGATCGCTCTGGACCCGGACCTGGCGATTCCGGACGTGCGATTCCACTGTGCCTCGCGGCCGAGCCTG
TTTGACTACCCGCCCGAGCAAGAGGTCAAGGCCGAGGAGGGACCGGCCCTGATCGCGACGGCGATTCTGTCGACGACAGC
CCAGGCAAAGCGGCGGGCGCAGAAGAAGGAGCGGGCGGCCCGGCGCGAGAGCATGGATGTGGACGCGGTGACGCCGGCGG
TGACAGCCAGCAGCGGCGGCGACAAGACGACGACGACAGCAACGACGGCCGACGGCGACAAGATGGACGTGGACGACGAC
AAGACGGCGGCTGGCGAGGACAGCAAGGACGAGGCAGAGGAAGCGATTGACGACAAGAAAGAGGGCGAGCCGAAGAAGAA
GGCAGAGAAGGAGAAGGTTGGCTACGAGATCTTCAATATGTCGCGAGTGCTGCCGGCGCAACTGAAGTACCTGAGCTTTC
CGTCTGGACGATACAAGCCGGTGAAGCCGGTAAGTGGGAGGAGTGATTTTTTGGGGGGGGTTTTTTTGGCAGCGAGCGTA
TGTGCTAACATGACATGTCAGCCTACCGGTGGCCCACTTCTCCTGATCGACACACAAAAGGATGAGCCTAAGACGCTGAT
CGAGGAGAAGCTGAAGAAGGTGACGATTGAGAAGGCGCCGGTGGCGGGTGCCCAGAACAACAGCAGTGGTGGTGGTGGGG
GTGGATCGGGGTCAGGAGCGGGTGGTGTGACGGCTGGCAGCCGCAGCGCGATGCTGCGGGACCTCTCGCAGGCGCTGCAG
GCACCTCACGAACTGCGGGCGATCACGGAGCTGCTGACGCAGAGTGGCGGCATCAACAGCGCCAGCACGGCCAGCCGGGC
AGCGGCAGCCCGCAGCGCAGCGCGGCTGTTTGCGGGTGCGCTGAACAGCAGCGATCTCGAGGAGCTGGCGGCGGCAGCAG
CTGAAGATGGCAACGGCGGTCTCGATGGTCATCCGGTTGCTGGTGAAGGCAGCGGCAGTGGCAGCGGTGCGGCAGCGGCG
GCTGGCGTGCTGACGGCTGTCGACGAAGATGGTGAGGGCGACGTGGAGGCGTCAGTGCCACAGGACTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62