GenePrediction:GLEAN_3491 Details

Name: GLEAN_3491
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:473443..476142 (+ strand)
Length: 2700
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:473443..473955 (+ strand)
Length: 513
Type: CDS
Source: GLEAN
Position: GCSC_156:474119..474235 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_156:474492..475611 (+ strand)
Length: 1120
Type: CDS
Source: GLEAN
Position: GCSC_156:475679..476142 (+ strand)
Length: 464
>GLEAN_3491 class=GenePrediction position=GCSC_156:473443..476142 (+ strand)
ATGCAGAGAACCAGTTCCGGCAGGCAGTCGCGACACAAAGACGGGCCAACAGACGGGCCCGTAAAAGCGGGGCTAAAGCG
GAGGGCGGATAAGGTTGGACATGCTGATTGGCTGCTGTGCGATGCGGCACCGTTGGGCCTGCAGCAGCGGCTTGGTAGCG
TTTTGGCCATGGAATTGGCAATTGGAATTAGTCGGCGGCCAAGCCAGACCGCCGACTCGTGCGGCCTTCCTTATCAGGAC
TGCGGACCTAGCAGGCCAGCCAACAGCGTGTTACCATCCCCACGCCACCGAGAGGAAGATCCTATCTACGGAGCGTGTCG
TGAAAGAGCCAATACGGACAAGGGCGTCTGGAAAACCAGGCTCGCTGGTCCGAGCCTGGATCCACGGCTAGAGGACCCCC
TGTCTATCCACCCCATGCCGTTCTGGCGTGGTACGGCATGGAGCTTGCCACCGTCGTCCGAGTCGAGCAGAACGGAGATA
CAGCCAGCGGCGAGAGATAGACTGATAAGACAGGTAAGATAGTACGTAGTGGGTTGTACGTAGTGTTTTTGGTCGGCGAG
GACAGTGCAAATATAAAAAACAGCCAGGATCCAGTTTCTGCATTTGTGCGCGCGTGCGAGTGTGTTTCCCGGAGTCTTGT
CCATTCTTGGTGTCTCATCCTCTCTCACGACCGCAGATAACAACCGCCAGGATGAAGAAGCCAGACACGACCGTCCTCAA
GCAGAGGTTCACCTCGGTGAAGGCATGGGAGCTGCCGAAGCAGTCGGGGTCGCTGGCGCCGCCAGATGTATATGTGAGTT
AAGGGGTGTGGGAGAGAGGAAGAGAAGAAAGAAGAAAGAAGAGGAAGAAGAGAAAGAAGAAGAGAAGAAGAAGAAAGAAG
AAAGAAGAGAAAGAAGAAGAGGAAGGAGAAGAAAGAAGAAAGAAGAGAAAGAAGAAGAGAAGGAGAAGAAAGAGAAGAAG
AAGAGAGAGAAAGAAGAAGAGAGCGAAGAAAGAAGAGCGAAAAAGAAAGAAAGAAAGAAGAGAGTAAAACAAAACAACTG
ACAAATCAGTCCAACAGCGACATGGACCCGACGCCGCTCGAGGAGCAGACCTGGACGGTCTGGAGCATCCTCGCGTACTG
GGCGACAGACGTGGTCAACCTGGGCACGTGGGAGACGGCATCGTCGATCGTGTCGGCCGGGCTGTCGTGGCGCGAGGCCA
TTCCATGCATGGTGGTCGGGACCTTTGCCGTGGCCATTCCGATGGTGCTGAACGGAGCGATCGGAGCGAAGCTGCACGTG
CCCTTTTCAGTCATCACGTCGTCCTCATTCGGCTACTACCTGCGCTACTTCTGCATCTTCTCGCGCTGTGTCCTGGCCAT
GTTCTGGCTCGGCATCCAGGGTGCCAACGGAGCCCAGTGTCTGACGGTGATGCTGACGGCCCTGGCGCCCTCGTATGCGC
GGATTCCGAACCGGCTGTCGGCCTCGTCCGGTATCACGACCCAGGGCATGTGCTCGTACTTTCTCTTCTGGATCATTCAG
CTGCCGCTGCTGCTGATCAAGCCGACCCATCTGCGCTACGTCTTCCTCGTCAAGATGGTGGCCGCGCCCGTGGCTGCGCT
CGCGATGCTCGGCTGGTGTGTTCATCGGGCCGGTGGCGGTGGTGAGATCTTCAAGCTGCGTGCCGAGGTCAGCGGGTCGA
CATATGCCTGGCTGTGGCTGTCGTGCATGACGTCCGTGACCGGCTCCTGGTCCACGCTCGCCTGCAACATCCCCGACTTC
ACCCGCTATGCCCGTGATCCCCGTGGCCAGTACTTCCAGCTGCCCTTTATGCCCATCATCTTCACCGTCTGCGGCCTGCT
CGGCATCATCACCACCTCGGCCACCAAGGTCATCACGGGCAAGTATCTCTGGAACCCGCTCGACATCATCTCGCTCTGGC
TCGACATGGGCTCCGGTGGCCGCTGTGCTGCCTTCTTCTCCGCCCTGGCCTGGTTCATCGCCCAGGTCGGCACCAACATC
ACGGCCAACTCCATCTCGGCCGCCAACGATCTGACCGTGATGTTCCCGCGCTGGATCAACATCCGCCGTGGCTGTGTCAT
CGCCGCCATCATCTCCGGCTGGGTCATGGTGCCGTGGAAGATTCTCAGCTCGGCCACCAAGTTCCTGAGCTTCATGAGCG
GATATTCTGGTAGGTGTTCTCTCGTTTTCCCTCCCCCCCCTCCTCTACCTCTCTTCAATCTCCCCTAACATGATAGTCTT
CCTCGCTCCCATTGCGGGCATCATGGTCGCCGACTTCTGGCTCATCAAGCGCGGCCACATCGACCTGCCGGCCCTCTATG
ACCCTCATGGCCGGTACCGCTACTACAAGGGCTGGAACTGGCGCGCTGCGGCCGCCTTCCTCATCCCTGTCGCCCCCCTG
CTACCTGGTCTCGGCGAGAGCATCAGTGGCGACTCGGCCGTCCACATCAGCGCCGGTGCCAAGCATCTCTACACCTTCAA
CTGGCTCTTCGGCTTCGTCACCTCCATCTTCCTCTACACCGTCTTCAGCCTGGCCTTCCCCGAAAAGGCCTCGCTGCTCA
AGGACACCATCTGGGCCAAGGACAGCACCGCCATCGACGGCGTGATCGACGCTAGCGATGTCGAGCACAACAGCGACTTT
GGCCACCACAAGACCACCATGGCGGACAGCACCATGGAGACCAAGGAGGTCTCGGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62