GenePrediction:GLEAN_3492 Details

Name: GLEAN_3492
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:476733..480160 (+ strand)
Length: 3428
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:476733..478434 (+ strand)
Length: 1702
Type: CDS
Source: GLEAN
Position: GCSC_156:478497..480160 (+ strand)
Length: 1664
>GLEAN_3492 class=GenePrediction position=GCSC_156:476733..480160 (+ strand)
ATGTCGTGGCTGTTTCCCAGACGGCAGCGCACCGCCATCGATCCCCAGACAATCGAGCAAGAGCATGATGTTGCTTCCAG
GCTCGAGCTCTCGCCCTTTGGCGTCCCTCTCCATCCGACCTCTGTACCGGTTGATTCAAGCCGTGTTCAGAAACCCAGGA
AAAGGCCCGTCAGCCGCCTATTGACAGCTGAAGATGGCTACACCCCCGGAAGCAACTCGCACAGAGGCCATGCCCGGCTT
TTGGGAGGGGCTTCCGCTGATGTCGGTGTCAATGCCAATCCCAAATCGGGGTTGAATCTGGAAAAGTGGATTCCTCTCTA
CGGCTTCCAGGGCCTTGTCATGTTCAACATCCACGACGACTACTCCCTCGTCGACGCTGTCGTCCGCCTCGCTCCACAGC
AGCTCCTGAACTTTGCCTTCTACGAGGAGACGACGCCCGCAGATGAAAGTTCCCAGGACAACAACGCAGCCGCCTTCAGC
CGTGAGATCCACGTCGACATCAGGGCCCAGAACTACTGCCGCAACAAGATTCGCTCCATATTCGGGTCTGACGACACCGA
GAAGACCCACGCTCTCTTTGTGTACGCACGCGACGAGCAGCCACCGCCGTCAGGCCGATGGCAGCCCGGGCCGGCCGACG
AAACCGACAGCCACGCTGTCCTCCGCTGTGTCCGGCGAGAGTACAGCGAGCTGCAGGATATTGCTTATCTCCGGCTGCCC
GTCAACGCGGCTCACCTGCGCTACAACCAGTACGTCGTCTGGCTCATGGTTGTGGCCCGCATCTTGACGCCCGGCTCCGG
CCTGCGGATGCTGCGTCTCGATGATCTGGGCGTGGTCGCCCACAGTTTCGTCGGCATCGACAACAGCCTGCATTCTGATC
TGCGCACACACGGCGCTGCCGGCTTCTCGCACTGGTCGTGGCGCGAGCTCGTCCAGGACGCGAGCAACGGCATCCGCTTG
ATCGCACTGGACGTCATACCCCTCGATCGTGCCACCCTGGCCGTCATGGTGCCGGGAATGAATCTGGGTCTCCGCGGCCG
CCATCAGCCCCATGTCCTCGTTGGTCTTCACCGCCTCGGGGACCATGCCGGTGACTTTTACGGCTCCCGTAACCGAACCG
TTGTGGCTGAGTGCATCAACAGCGTCGTCAACGCTTCTACCACCGCGGCCGAGAAGGAGATGCTGCAGTATGTCACTGTC
TGGGGCAGCGGCGCCTTCTGGATGTCCGAGGGTGCACCCCTGCACAAGTTTCCCCTGGCGCCCCATTGGATCGACTTTCC
CACTGATGCTGGCCTGTCGTCAGGCTTCGTCGTCGTTCGGCCCGGCTACCCAACGTACACGGCGCATGTGTTTAGTCCTC
GAGACGGCGCCGATGGCGGGAACAACAGCAGCAGAAATCTAACGCATTTTGAGTTTATCATGGACGCAAAGCTTGACGCC
TTTCGACAGCGTATGCGAGAGGCTGGCCTTGGTCATCTGGAGCAGAGCTGTCTGCGCATCAGTCAGAAGGACCCAACACG
CCCACAGATCTCCGACACTGCTCGGTACAAGAAAATGGATGCCGATGAGAGGACGCGCAATAACCGCATGGAGTTCAATC
TGGAGCCCACGGCGAGTAACGACATGTGGATGTTTATCTGCAGCCAGATTGTCGGGCAGGACATTTATATTGAAGAAGCC
CCTGCCGAAAGTATTCTCCCGGGTAAGTCTATTCTCTTGATACCAAGGAGTGAATGAAATACAAAAGACTTACTCGTTAC
ACAGATGTTGATCTTACGACGAATCTCTGGGGTTACCGTTCGACCTACGACAACATGTTTAGCCACAGCCAGCACATCGA
GGTCGCCAAAACTATGCCGGCCGCAGCAGCAGCTCTTGTTGCTTCGGCTGCTGCAGCAGAACCTGCGAGGCAGAAGACGG
CTACCAGCTTCTTCCAAAATGCTGCTCAGTGGGGCGGCAATCTCGTGTCCAAACGAAGGCATCTTGAGCCATTTCCGCTT
CTCGGTGGCCAGAACGGTCAAAATGGCCAGAGCAGGGCCGTTGACCCTTTGGGCTCCTGGAAGATGCCTCTGAAAATGTT
CTTGCGCGGTGGTCCCGATGCTCTTCCGTTTGCGGTCGGCCGAGCCGTGGCGACACCGAACGAGACGGCCGCCCTCAACC
TCATGGCTGCCGACCTGTACGATCTAGCGCTGCAGCGTGTGGCCCCGTGTCCCTATGCACATGAAGATTGCCAGTCCTTC
TTCGTTGCCGGCCAAACTCAGGTGATCCAGGCCCATATTGCAAAAGCACATCCGCCGCAGAAGCAATGTCTCTTTTGCGA
CCACTTCTTTTTAGCCGCCGCCAGCGTCAGTGATAAGCTGGATCACCTGATTAACGTTCACCGGTCCTTCTTTTTCAGTG
CTGCAAACGGCAACTCACTGCCACCTCCGCCACCGCCGCCACCAGCACCGCCAGCACCTCTAGCACCGCCAGCACCTCCA
GCACCTCCAGCACCTCCAGCGCCTTCAGCGCCTTCACCATCCTCAGCGCCCCCAGCACCCCCAGCACCCCCGGCAAAACC
ACAAGCTCCCCTTCGAGGTGGAGATGGAAACAACGCAAACCCTGCTGCTGGCTCTCTTCAAACAGCAGGACCGACTGCTA
AGAAGAAGCGCCAAGTGGGTGCAAATCAGCAGAGTGATCCACCCTACCGACCGGGACAAGACATAAACGGATCGTCGACG
GACGATATTAGCGATGAGGGAAATGATATCACGGACGATGATTTGGTTGAAGGCAGTCGTCCGCGGAAAAGGAAGCACGG
AACAGAAGACCCAACATATCGGCCGGCCAGAGATGGAGATGGAGATGAAGAGGTGGAGGAAGGGAACAACAGCGCATTTC
AGAAAAGCAAGAAGACGAAGCGAGGAGCGGCCGCTGGCAGTCGACCAGATCTTCAAGACTCTCTGTACCGCCCAGGGCGG
AATATTGGCGTGTTGGATTACTCGGAAGACGCGGACGAAGAACTAAGGAAGTCAGCTGCGACTGAATGGGGTCGTGATCC
GTTTGACCCGACCGGTAAGCGAAAGCGAGTGATCAGAGAGAAGCCTGTGGTGCCAGAGGAGATGCTAGAGACGACGAGCA
CGATTGCGGAGGTGGAAAAGCCGAAGACGGCAAAACCAAAGAAGACAAAAAAGACAAGACCAACTGGAGGGATAGGGAAA
ACAGGGGGGACAAGAAAGACAATGGGTCAGATCCGGACACCGAAGCAAAATAAGACGACAAAGCCCGTGAAGAAAGCAGA
AGTGTTGAAGGCGGTAATACCAGAACCATCCGAGTTGCTGAAGCCGTCAAAGCAGAGCGAGACTCTGGTTTCTCAGTCGA
CAGCTGTGCCAGCAGAGGTCGCCCCCAGAAGGTCGGGCAGAAAGCGGATACCGCGGATGCTGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62