GenePrediction:GLEAN_3494 Details

Name: GLEAN_3494
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:494498..495814 (+ strand)
Length: 1317
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:494498..494682 (+ strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_156:494740..495814 (+ strand)
Length: 1075
>GLEAN_3494 class=GenePrediction position=GCSC_156:494498..495814 (+ strand)
ATGCCGGACAGCTCGGCCACCGGGCCGCCCACGACGTCGGCCCCGATCTTTGGCATCGACATGCGCGGCGAGGTCAAGAA
GCCCAAGAAGCGCAAGGTCCTGCTGATGGGCAAGAGCGGGTCGGGCAAGTCGAGCATGCGGTCCATCATCTTCAGCAGCT
ATCTGGCCCGGGACACGCGGCGACTGTGCGTGCTACCTCCTGTTTATTTCCCTGTCGCTGTTGCGTGCTAACGTGCGTCC
AGTGGTGCCACCATCGACATTGACCTCTCACAGGTCAAGTTTCTCGGCAACCTGACGCTCAACCTGTGGGACTGCGGCGG
CCAGGAGGCGTTCACGGAAAACTACCTGTCGCAGCAGCGGCAGCACGTGTTCAGCAACGTCGGCGTGCTCATCTACGTGT
TTGACATTGAGTCGCGCGACGTCGAGCGCGACCTGGCCACGTACGGCTCCGTCATCACGGCCCTGACGCAGTACTCGTCG
GGCGCCAAGGTGTTTGTGCTGATCCACAAGATGGACCTCGTCGTGGCGTCGTCGCGCGAGGCCGTCTTTGAGGAGCGCGT
GCGGTTGGTCCGCCAGAAGACGGGCGAGTATCTGCGCAACGTGGCCGATAGCAGCAGCAGCAACAACAACGGCAACGGTC
CCGGAGCAGACGGCTCCAACGGCGATGGCGACGCGGCAGCCGACCTGCGACTGACACCGTTTGCCACCAGCATCTGGGAC
CAGTCGCTCTACAAGGCGTGGGCCAGCATCATCCACGACCTGGTGCCGAATCTGGCGCTGATCGAGACAAATCTCGGTCA
CCTTGGCCGCCTGGTCGAGGCTGAGGAGATGCTCCTCTTCGAGCGCACCTCCTTCCTCGTCGTCTCGCACTGGAATAGCG
ACGAGGGCGCGCGCAACCCGTGCGAAGACCGCTTCGAGCGCATGAGCAACATCCTCAAGAGCTTCAAGAGCTCACTTGCC
CGCTATACCGGCACGCCGCGCAACGCCGAGCAGTTCAACCTGTTTGAGCTCCGCTTCGGCCTGCGCTGCAATCTCTTCAT
CGGCAAGTTCACCACCAACACGTACATCCTTGTCGTCCTGCCGCCCGGCGAGGCTCGCTTCAACGCTGCCCTGCTCAACA
CCCAAATCGCCGCCAAGCAGTTTGAGTTCCTCGACGTCCCCGCCGGCCTCACAAAGGACTACAGCCAGACACAGCAGCAA
CAACAGCAACAGCAGCAACAACAACAACAACAACAACTGCAGCATCGTCCACACCACGGCCAACATCACAGCCAGCACCA
CGGAGATCCCGCGCTGGGCTCATCCGTCTATGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62