GenePrediction:GLEAN_3495 Details

Name: GLEAN_3495
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:498106..498508 (+ strand)
Length: 403
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:498106..498375 (+ strand)
Length: 270
Type: CDS
Source: GLEAN
Position: GCSC_156:498437..498508 (+ strand)
Length: 72
>GLEAN_3495 class=GenePrediction position=GCSC_156:498106..498508 (+ strand)
ATGGCCTCAGAGGAAGCCGTCAACCCGATGGCCGAGTCCGGCGTGACCATGCACTCGGACAGCGAGCAGTACTCGGGAGC
CGAAGAGCTGTCTGCGTCGCTGGAGTCGTCGCACTCGCCTGTCATCCTCTACCAGCCGCCCACGGTCTGGTCGCTGTTCC
GCGGCGCCGCCATCAACCTCTTCCTGCCGTTTGTCAACGGTCTCATGATGGGCTTCGGCGAGCTGTTTGCCCACGAGTTT
GCCTTCCGGCTCGGCTGGAGTGGAACCCGCGTGCGTTCTTTTCCAGACGTCTTTCTTCCCTCGGCCACCTCGTCCGCTAA
CTCTCCCGCAGGTGTTTCCCTTGTCCAGACGGACGGCCTATCCGGCCGGCCCGGGCATCGAGGTGAGGCAAAAGCGGGCA
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62