GenePrediction:GLEAN_3496 Details

Name: GLEAN_3496
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:499030..500758 (+ strand)
Length: 1729
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:499030..499086 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_156:499164..500117 (+ strand)
Length: 954
Type: CDS
Source: GLEAN
Position: GCSC_156:500171..500758 (+ strand)
Length: 588
>GLEAN_3496 class=GenePrediction position=GCSC_156:499030..500758 (+ strand)
ATGCTCCCCAGCAGAGGTGTGATCCGGTCGGGCCAAGCCATGCGGCTTCGGCAGATGGTACGAGCTGCACGGATCTGGCC
TCTCGCCCGATGACCCTGTCCTGTTGACCCTGCTGACCCCCCTCGTGTTGGCAGGCCACGCAGCAGTCCCGCGCCGGATG
CGCACGAAACTTTGCCACGGCGCTGAGAAAGCCCGGCGGTCTCGGCCGGCCGGCCATGTCGATCGCACAGCTCTCTGGAC
GGAGGATTGGCCTCGTCAACGGAGCTCCGACTACGCTTCCCTCGTCCATGGCCGCCTTCTCTCTGTTTCCGTGGCGGTCC
AAGAATGCGTCCGCAGAAGTGCTGCCAGAAGGAGCAGTGCCAGAAGCGGCAGTATCGCCACAATCCACGGCTACAGCATC
CACTGCCTCCACACCATCTACACCATCCGCACCATCCACGCCAATCACCCCCTCTGATGCCGTCCAGCCAGACACCCTTG
CGGCTGCCGACCCGACGACGACGGCCGCCTCCGTCTCGGACCTGCTCGACGGCGGCGCACTCCTGGACATGCCCGAGCAG
ATCGGCTACCTGCACGCGATGGGACTCGACTTCGGCTGGGGCCCCTCGAGCATGTGCATGTGGCTGCTCGAACACGTGCA
CGTCTACACTGGCCTGCCGTGGTGGGCGTCGATCGGCCTGACCGTGCTGCTGTTCCGCAGCGCCATCTTCTTTCCGTCCC
TGACGGCGGCCGAGCAGAGCGCCCGCTTCCAGAAGCTCCGAGCCGACCCCAAGTATGCGGCCGCCATGACGGAGATGCAG
CAGTCGGCTATGCGTGGCGGTCAGCTGGCCCAGGGTCGTGCCATGGAGCTGCGCATGACCACGAAGCGCATGCAGGCGGC
TGCTGGCGTGTCCACCTGGAAGATGTTCATCCCCATGATCAACGTGCCCTTTGGCTACGGCATGTTCCGACTGCTGCGCT
CCATGGCCCTGCTACCGGTTCCTGCTCTCGAGACCGACGGACTGCTCTGGTTCCAGGACCTGACCGTGCCCGATCCCTTC
TTCGTCCTGCCCATCGCCTCCGCCACCATCATGTACCTGATCTTCCGTGTGAGCATTTCCCCCTCCTTTGCTACCCCTTT
TCTCCACCACTAACATCCCAGAACAATATCAAATACATGGCCCCTGAACAGGCTCAGCTCATGAAGATGATGCAGATCGT
CATCACGCCCGTCAGCATCCTCGTCACCGTCAAGATGAGTGCCGGCCTGACCCTCTTCTTCTTCCTCTCGTCCGTCCTGC
AGATGGTTCAGACCTGGCTGTGGCACCAGCCTTGGCTGCGTACCTGGAAGGGCCTGCCACCACTGCACACTCTCATCCAG
ACTCCTGGCGTCGCCAAGCCTGCCGCCTCCTCCACCACTCTCCGCCTCTCGCCCGCATCCACCTGGCAGGCTCCACGCGC
CATTAGCACTTCTGCTACCGTCACTGCTTCTGGCTCCGAGGCTGCCAAGCCGGCTGGCCCACCTTCCACCGTCGACGTCG
TCAAGAAGGGCTGGAACAAGATGATGGGCACGGCCAAGGACAAGCAGGGCGCTTCCAAGGACAAGCAGACCTTTAAGGCT
GCCCTCGAATACGAGAAGAAGCGCGCTGCCGAGGAGGAGGAGAGCCTCTACCGCCGCCGCGAGGCCGAGCGGCAGTACCG
CGAGATGAAAAAGGCCATGGCTCGAGGGACCGCCGACAAGAAGCCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62