GenePrediction:GLEAN_3497 Details

Name: GLEAN_3497
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:507200..508860 (+ strand)
Length: 1661
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:507200..508372 (+ strand)
Length: 1173
Type: CDS
Source: GLEAN
Position: GCSC_156:508438..508546 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_156:508607..508860 (+ strand)
Length: 254
>GLEAN_3497 class=GenePrediction position=GCSC_156:507200..508860 (+ strand)
ATGATTCTCGAAGAGATCCGGTACATTCTCGAGGATCTCGAGCGGCTGGAGCAGGCGATTGTGGACCGGCTGGTCGACGA
GCCGGCGCAGATCCGCGATCGCCTCAACCGGCAGCATGAGGTGGCCCAGCTGCTCGACCACATGCAGAAGCAATCGAGCG
AGGCGCTGCAGCTGTACGGCAGCGCCCAGGGCGAGCGTGCTGAGGAGGTGCGTCTGGTCGGCGACTCGGGCGACCCGATG
GACCTCTTCTACCGGCAGTGCGAGGACACGCTGGCCTACCACGCACGCTATCCCAACGAACCGATCGACCAGCCGGAGCT
TCGATACCGGCCCAAGCGGCCGGCCGACCTGTCCGAGCTGCAGCCGACGCTCGTCGACACCATGTTCTCGGGTGAGGAGG
GCTTCGGCCGCTTCTTCGACCTCAATGCCAGCTACGAGCAGTTCATCAACCTGCCCAACGTCAAGCGCCTGACCTACCTG
CAGTACCTCGAGGTCTTTGACCACTTTGCCCCAGGCGCGGCCAGCGGCATCAAGCGCGCCGACAAGCTAACCGAGGACTA
CCTCCGCTACGTCGGCGACCTGGCCGCCTACCTCGAGTCGTTTATGCGCAAGTCGCGCCCGCTCGAGAACCTCGACCGCG
TCTTCGGCGGCTTCGACGACGACTTTGCCCGCCTCTGGGCCGGCGACGAGGTGCCCAACTGGAAGGCCGACACGACGGCC
GAAAGTGCCGGCAGCAGCAGCAGTGACAGCCACCCGCCGCTGACCTCACCCGACGCCGTCTGGTGTGCCGACTGCGAGAA
GGAGTTCAAGAACGAAAACGTCTACCGGGGCCATCTGTCTGGACGAAAGCACGTGCGCGCGGCCGAGCAGCGCGCCCAGA
GGATGTCCAGCGGCACCGCCGGCGGAGACGGTGCCGGCGCCGGTGCCGAGGCACACCGGCTACGTGAGCGTGCCGTCGCC
GAGCGCGAGTACCGCGTGCAGCGGCTCGTCGCCGCCATGAGCACCGAGAAGGACGACACGCGCACCAATGTCGAGCGGCG
CCAGGGCATGACCGAACGCGAGCGGCAGCAGGAGCTCGAAAACCTCTACAGCATGACGTCACAGCCGTCACAGGAGATGG
AGCTGGACGGCAACGAGGACGAGGACGGCGACGACAAGATGTACAACCCACTGGTGTGTTATGTTCCTGGTCGAGCTTGC
TTGTTTGTTTGGGTGCTTTGACTAACATTTGTGTGCAGAAACTTCCGTTGGCTTGGGACGGCAAGCCGATTCCGTTCTGG
CTGTACAGACTGCACGGCTTGGGCGTGGAGTTTGACTGCGAGATCTGCGGCCATTTTACCTATATGGGTACGTTCTGTTT
CTCTCGCCTTGCACTCTTATCGCAATGGCAGTCGCTAACTCTTCTAGGCCGCCGCGCATTCGAGAAACACTTCAACGAGA
GCCGGCACATCCATGGCCTTCGGTGTCTGGGCATCTCCAACCCGACCCTATTCCGGGATATCACTAGCATCGAGGAGGCT
ATGCGGCTGTGGGACAAGCTAGAGAAGGAGAAGAAGAAGACCAAGATTGACGACAGTTCCGTCGTCCAGATGGAAGATGC
AGATGGACACGTCATGCCGGCAAAGGTGTACTACGACCTGCAGAAGCAGGGGTTGTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62