GenePrediction:GLEAN_349 Details

Name: GLEAN_349
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1193724..1195066 (+ strand)
Length: 1343
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1193724..1193778 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_167:1193844..1194693 (+ strand)
Length: 850
Type: CDS
Source: GLEAN
Position: GCSC_167:1194748..1195066 (+ strand)
Length: 319
>GLEAN_349 class=GenePrediction position=GCSC_167:1193724..1195066 (+ strand)
ATGTTCTCCAAACAGGTTCTCGTTGCCGTACTGGCAGCAGCTGGTGCCGTCTCTGGTAAGCTTGCCATTTCCGTACTGCC
AGACTTGCCTGTGTTTTAGCTCTATTGACACGCGTTCCAGCGGCCGCCAACTGCACCCAGACGACTTTCACCATCAACTC
CCAGGCCGACTTCGACGAGATCTCCAGCTGCACCACCCTTACGGGCGATGTCACGATCGGCACTAGCACGGATGTTTCGA
TCGATCTGAGCGGTCCCAAGGCCATCAAGGGTGACCTGACCCTGCTGAACAACAAGCTGATCTCCACCCTCAAGAGCTCC
AGCCTGCAGAGTGTGTCGGGTGCTTTCCACCTGCAGAATCTGACGACGCTGTCGACGCTGTCGTTCACCACCCTGACGTC
GGTCGGTTCGATCAACTGGGTCTCTCTGAACGCCATTGACGTCCTGACGTTCACGGCTGGTGTGACCAAGGCCGCGAGCG
TCGTTATCAGCGACACTTTCCTGAGCAGCCTGGACGGTCTTGATGTTGCGTCTGCTAGCACCATTGACATCAACAACAAC
CGCCGCCTGATCAAGTACACTTCGTCTCTGGGCAACCTGACTGATCTCCTGAACATCAACGCCAACGGTCTTAACCTGGA
AGTCAGCTTCCCGAACCTGATCTGGATTGCCAACATGACCGTTTCGAACGTGTCCAGCTTCAGCGTCCCGTCGCTGGCCA
CTGTGAACGGCTCCATCCGCTTTGACTCCAACTTTTTCACTTCGTTCAGCGCACCGAACCTGACGAGCACCCAGACTGGC
GATGTGTCGTTCATCAGCAACGCCGACCTGGCCAACATCTCGATGCCCCTCCTGAAGTCGATTGCTGGTGGTCTGCAGAT
TGCCAACAACACTGCCCTTCAGAATGTCACCGGCTTCGCTGCCTTGAAGACCGTCGGTGGTGCTGTCAAGCTCCGCGGCA
ACTTCACTGAGTAGGTTCAGAGTGCATCTCCAATTATGTTCGGGTTTACTAATACCTGTTTTAGGGTTGAGCTGCCCAGC
CTGGCTGATGTCAAGGGTGCCTTCAACGTCGAGTCCACTGGCGATATCACTAGCTCGTGCGCCGTCTTCAAGAAGCTCGC
TCCCTCGTCTGCCGGTGGCAACGGCGATATCCAGGGCACCTACACCTGCCAGAGCGACAACGCTAACGCCAACTCTGACA
CGTCTACCAGCACTGCTAGCAGCACGAAGTCGAGCAGCACTGCGAAGGCCACTGGCTCCAGCAGCGCAGCAACTGGCCTG
GGCATCAACGGTGTGGCCGTCGTCGGCCTTGCCGGTGTTGCCGCGCTGGCTCAGCTGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62