GenePrediction:GLEAN_34 Details

Name: GLEAN_34
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:254386..256094 (+ strand)
Length: 1709
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:254386..255150 (+ strand)
Length: 765
Type: CDS
Source: GLEAN
Position: GCSC_179:255204..255349 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_179:255509..256094 (+ strand)
Length: 586
>GLEAN_34 class=GenePrediction position=GCSC_179:254386..256094 (+ strand)
ATGCCCGACCCAGGCCTGATCGCGACGCTCCATGTGGCCGGTCCGCACGAGTCGAGGAAGACGGCTGAACGCACGCTCAT
GGCGAATCAGAACCGATTGCCATTTATCAGCAGTTGTGGCAGCAATGGCAGCAGTAAGATGTCTGGCCTCTTCCAAGCCG
CCCGGCTGCAGCTCCGCTTCGACAGCCTGCGACGCAACCGGGCCGGCTTCGTCTTCGGCTCGAGCACGGACTGCGATATT
GTCCTGCCCAGAGGCCTAGCGCCGTATTTTTGCATCCTCGCCTTTGATCTGCAGCGACGGCTTATCCTGCGCGAACTGCA
GGGCGCCAGCCTCTCGGTCCGCTACGGCGACAAGGCCGGCCATCCGCTCTCCGGCGCCGTCTGGCTTCTCAGCGGCCACC
GCTTCACCGAGAAATATACGCCTTTGGTCATACGGCTGAGCGAGACCCTCAGCTTCCGCATCGAGGTCGCCGCTCACCAC
ATCGACTCAACTGTCTACCAGACTAGCGTCGATCGCTTTCCCGACCACTACGACGCCGCCTGGAACCTCGTACCTGACCC
CGGCTTCACCCACGACGATAATCCCCCGCCCGGCCCCGCCTCCGTCTTGCTGGATGATCGCCAGCTCGGCCGAGGCGGTC
AGGCAAGAGTCGACCGCGTCTGGGATGCCCGCACCGGCATCTACTATGCTGCCAAGATCCCTCTCCGTGACTCCTGCTGG
AGACGGCTGAAAATTGAGGCTAGCCTGCTGGCAAGAATCGACCATGTAAGTCCGTCCCCGAAATTGCCGATCGTTGGCTA
GGATATTCACCCTGTCAGGAACACGTGATCAAGCTGCTTTACCTGTCGCCGTCGCCAAACCGGCGGCTGATTCTGGAGTA
CGCTGCCGGCGGAACGGTCGCCAAGCTAGCAGCCGATAAGGCCATATCCTGCGACGAGAGCCTGGCTGTTGTCGGCCAGT
GTCTGTCTGCCCTGGCTTACCTCCACCGCGGCTACATTGTCCATTGCGACATCAAGCCGGCCAACATGCTCGTCGCGTCA
CGAGACCCCCTCCGCGTCAAGCTGTCCGACTTTGGCTACTCCCGGGACGTCGGGGACATGCCCAACACGCGCATCGGCAC
CAGCCTCTACATGCCCCCTGAGGCCCGGGAGGCCCCCGACGTCCGCGAGGGCAGCCAGTATACTTGGGCCGTCGACATCT
GGTCTCTCGGCGTCGTGGCCCTCGAGCTCACCCATCGCCTCCCGGCCTACCGGCCCAGATACCCCCGAAGGCTTGTCCGG
GACCTTGGCGAGAAGAAGAAGAATCGGCACTGCCCCCTTCTCGACTTTCTGTCTACGGCCATGGTCGTCATGGACCCCCG
GAATCGCTGTTCGGCCGACGTGTGCTACGACGTCTTCCATCACGGGTCGCTGTGCTGCTGTCCGCCCGTGTTGGCGACGG
CGACGACAGAGCCTCCGAAGCAGGAGCTGGCTCCGGAACAGGGGCCCACAGAGACGACAGAGCCCCCGTCGTGGGTCCGC
GAGACCCTCGTCCACGCCGACTACACCGAAGACGTGCACACGAGCCCATGCTATGGCGTGGCCGACGTCTGCTACAGCCG
CGACGGATATGCAGTGCAGGCTGTCTACAGCTACTTTCCCGGCCTGACCGAGTCTGCCTATTCGGAGCAGCCAGGACAGG
CAGCCATGCCGACGGCATTCGACTGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62