GenePrediction:GLEAN_3501 Details

Name: GLEAN_3501
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:533486..536644 (+ strand)
Length: 3159
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:533486..533549 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_156:533823..536644 (+ strand)
Length: 2822
>GLEAN_3501 class=GenePrediction position=GCSC_156:533486..536644 (+ strand)
ATGCTCCAAGCCAGGACGTTTGTGGCCCATCCCCCATTGCGCATTGCCGCCCTCAAATCTAACTGTCCCGTCTTGATATT
GAACCCCCCTTGCTATCTATAGCCAGCCCTGCAAACACTGCTGGCAGTGCTTGTATTGCCAGCGTGTCGTCTTTGCGGCC
ATGCGTTCACAATTGTCAGGGCAGGCATTGGCCACATGCCTTGGTCTGCTATCAACCCTTTCCTCCTTGGTCATTCCAGC
ATGTAAGGACAGTTGCGGAAGTCTTGTGTATTCCCCGGAATTCTTCTATAGAAGCACCTGCTACCTCTACCGGATATCTG
GCTAACAGAGAGCCCAGATGCGGTCAAGGAAAATGACTTCAAGAAGTGCGATCAGTCGGGCTTTTGCAAGCGCAACCGTG
CCTATGCAGACAACGTCGTTGTCGCAGGCTCCTCGGCAGTCTCGCCGTACCATATATTGCCGGAGACTGCAGCAGTCAAA
GACGGCCAATTCCAGGCTGTCATTCTGAAGACCATTAACGACCAAGGCGAGACTGTGCGGCTCCCCCTTACGGTCTCATT
CACCCAGTCCGGTGTGGCTCGTGTCACAGTCGACGAGGAGAAGAGAAAAAACAAAGAAATTGAGCTCCGACATGGCAGCG
GTGCGCGCAAGGAGCGGTACAACGAAGCCGAGAAATGGGCCATTGTTGGCGGCCTGAATCTCGACAAGGAGGCCAAGATT
GTTGACGGGGGTAGCGAAGGGGACACGGGCGTCACGATCCAGTACGGGCCGTCGGGGCAGTTTGAAGCTCAGATCAAGTA
CTCACCCTTCAGCGTGGACTTCAGGCGGGACGGCTCGACTCAAATCAAGTTCAACAAGGGCGGTCTCATGAACGTGGAAC
ACTGGCGACCAAAAGTCGACAAGGAAGAAAGCGCCGCCACGTCCGAGGATGAAGGGATGTGGTGGGAGGAGACATTTGGC
GGCAACACTGACACAAAGCCGCGAGGCCCTGAGAGTGTTGCTCTGGATATTTCCTTCGAAGGCTACGGCCATGTTTTTGG
TATCCCGTCTCACACTGGACCGCTCTCGCTGAAGGAGACCCGCGGTGGTGAAGGCAACTACGCCGAGCCGTATCGTCTGT
ACAACGCTGATGTTTTTGAGTACATCCTCGATAGCCCGATGACGTTGTATGGCGCCATCCCTTTCATGCAGGCCCATCGC
CCGGATTCCACGGTCGGCGTCTTCTGGCTCAGCGCTGCAGAGACGTGGGTCGATATTGCCAAGCAGAAGGAGTCTATCAA
CCCCAACGCTCTGGGTGTTAGCGCTCGGACTACCACACAGACCCATTGGATGTCTGAGAGCGGCTTGCTCGATGTCTTTG
TGTTCCTGGGTCCCTCCTCGCAGGACGTTCTGCAGAAGTATGGCGAGCTTACGGGCTACACTGCCATGCCGCAGGAATCG
GCGCTGGGATACCACCAGTGCCGCTGGAACTACAACTCGGACGACGACGTCAAGGACGTCGACCGCAAAATGGACAAATT
CAACATCCCCTATGACGTCATTTGGCTCGACATTGAGTACACGGATGGCAAAAAGTACTTCACCTGGGACCAGGACAAGT
TCAAGGATCCTATTGGGATGGAGGAGAAGCTTGACGAACACGGCCGCAAGCTGGTGGTCATCATCGATCCGCATATCAAG
AACGAGGATGGCTACGAGGTGGTGTCGGAGCTTCAGTCCAAGGAGCTGGGCGTCAAGAACAAGGAAGGAGGCCTGTTTGA
GGGCTGGTGCTGGCCAGGCTCTTCGCACTGGCTTGACGCGTTCAACCCCAAGGCGATTGAGTGGTGGAAGACGCTGTTCA
AGTACGACAAGTTTAAGGGAACGTCTGAGAATACGTTTATCTGGAACGACATGAACGAACCGTCAGTCTTTAACGGACCG
GAGACGACGATGCCCAAGGACAACATCCACCATGGCGGCTGGGAACATCGTGATGTGCACAACATGAACGGAATGACCTT
CCACAATGCGACCTACCAGGCCCTTCTCTCGCGCAAAAAGGGTGAGCTGCGCCGTCCTTTCATCCTGACGCGTTCCTTCT
ATGCCGGCTCGCAACGGCTGGGCGCCATGTGGACAGGCGACAACCAGGCTGCCTGGGACCATCTGGCTGCTGCCACGCCC
ATGATTCTCAGCCAGGGCGTCGCCGGGTTCCCTTTTGCCGGTGCGGATGTGGGCGGATTTTTCGGCAACCCGGACAAGGA
TCTGCAAACCCGCTGGTTCCAGGCCGGCGTATTTTACCCCTTTTTCCGCGGCCATGCGCACATTGATTCACGCCGACGTG
AGCCTTACCTGGCTGGAGAGCCGTATACTGCCATCATCACGGCGGCGCTGCGTCTGCGTTATAGCCTGCTGCCGGCCTTT
TACACAGCCTTCCACGAGGCGCATGTTTCTGGTACACCCATCATCCAGCCGCTCTTCTACACCCATCCCAATGTAGAGAG
CGGATTTGGCATTGACAACCAGTTCTTCGTCGGCTCTACGGGCCTGCTGGCGAAGCCAGTCGTGGAGGAGGGCAAAGAAA
CGGCCGATATCTACATTCCCGACGGTGAGGTGTACTACGACTACTTTGACTACACGGTCGTGCCCACGCTGGCAGAGCAC
ATCACGTCGATGGAGGCACCCCTGGACCGGATCCCGCTGCTCCTCCGTGGCGGCCACATCTTCCCGCGTCGTGACCAGCC
GCGCAGGTCCAGCGCGCTGATGAAGTACGATGACTACACCATTGTGGTCAGCGTGCCCAAAGACGGTGGCCATGCTGAGG
GTTCGCTGTACGTCGACGATGGCGACTCGTTTGACTACGAAAAGGGCCAGTACATCCACCAAAAGTTTGTGCTGGACGGC
GCCGAGCTGTCGTCGACAGAGGCAGAGGGCCGTGTTATCAGCAAGATCAAGCCCGGCGCATGGCTGAAGGCGATGAAAGA
TGTGCACGTCGACAAGGTCATTGTGGTTGGCGCCCCGGCGTCGTGGGCAGCAGCAAAGGAGGTGACGGTGGAGTCGCAGG
GCAAGACGTGGACTTCGCCAGTGGACTACACGGCGGCGGAGAATGGTCGCGCGGCATTTGCGGTGGTGCGGCATGTTGCT
GCTCGCATCGGTGCTGACTGGAAGATTTCCTTTGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62