GenePrediction:GLEAN_3504 Details

Name: GLEAN_3504
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:543093..545939 (+ strand)
Length: 2847
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:543093..543482 (+ strand)
Length: 390
Type: CDS
Source: GLEAN
Position: GCSC_156:543553..544377 (+ strand)
Length: 825
Type: CDS
Source: GLEAN
Position: GCSC_156:544513..544518 (+ strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_156:544648..544938 (+ strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_156:545380..545699 (+ strand)
Length: 320
Type: CDS
Source: GLEAN
Position: GCSC_156:545759..545939 (+ strand)
Length: 181
>GLEAN_3504 class=GenePrediction position=GCSC_156:543093..545939 (+ strand)
ATGCCCTTTCTTTTCTCCCATGTCTGCGACCTCCTCCAGCAGGCGGCCGATCTTCCGCTTGTTCGCCGTGTCCAGCCTGA
TTCTGTCCAAAAACTGATCCGCGACTGGTTTAACCAGCACCGGCCTGCCATCGATGCACTGATCCATGACAGCAGTGCCG
GTGCCGTCGACGGTGCAGCCTCTGCTGCTGCTATTCTCTCGGCCCTCTTGCCCGACCATCGCACAGACCGCGTCTATGGC
ATCCAGGCCAAGTCTCTCCAGCGCATTATCGCCCGGGCTCTTGGCCTTGGCCATTCCAGAATTGCCGAGTTGGCTCGCTG
GACCCGACCTCCCGTCGACGGCGATGCCGTTGACCTTGCCGACTGTGTTGAGTGCATCCTGCGCCGGACGGTAGGTTTGT
CCTCTTGTTTGAATTCTGTATTCGCACGTGTCTTTCTATCAGTCTAACAGGCGCCACCAGCCCAACTCACTCGATGGCCC
GTCTGTCTATATCGAGGACATTGATGCCATCCTGAACGGCCTTGCTGCTAATTGTCGATTCAGCTCGCCGGCCATCCGAC
AAATTAGCCAAGCTCCCGCTTCCAGGGACTCCGCAGTTGTACCTTCAGCTTTCTCTATTGCCAATGCCGCAGACTCGAAC
AAATCTGTGCTGATGCGTGACCGTGTTCTTGGCCACCTCTATCGCCGTCTTAGCGCTCGCGATGCCAAATGGCTGACGCG
CCTTATACTCAAGGACTACCGCCCCATCGTGCTAGATCAGGCGACCGTCTTCCGTGCCTTTCATCCGGCTTTCCCCTTGG
CGCTGCGCGTTCACAGCGACTTTGTCACGGCCATGCAGTCGCTCGGTCAGGGCGATACGGAAGGTCAAGAGCAACAAGAA
GGAAAACCGGTGTCTCAAAGCGGAGCAAGTTCTGGCTTCTCCGGTTGCTTGGCCACTCAGCCAAAAGTTTCCCGAGCTTA
TTCTCATTGTCCCCGACTTGGTGTCAAGGTCGGCCGACAGCCATGGGCCAAGGCCCGCAGCATCAAGCATTGCCTGGCCA
TGGGAAAGGGGCGACGCATGAGCTGCGAGCGGAAGCTGGATGGTGAGTATGTGCAGGTCCACGTCGATCTTAGCAAGGGC
CGGAAGAACTGCTTGCAGCTCTTTTCGAAGAGCGGCAAGGACAGTACGCGGGACCGCTTCCGAGTCCACAACTGCATTCG
GGCATCGTTAAGGATCGACGAGGACGACTGCCCCCTTAGCACCGGTTGCATCCTCGAGGGAGAGATGTTGGCGTTTAGTG
AAAAGGTATATCTCCATGTCTTATCTGGGTTCCGAAAAGCACGCCAGTCGCTCACCATACAAGGAGGGTCATATTCTTGA
CTTCGATGCCGTCCGCAAACACGTCACTCGCAGCGGATCACTGATATATTGTGACGCCAGAAAGAGGTATGTGCGCTTTG
TGGCTGATAATTCACTTGTTGCCATTGATCAATGTTTTGCAGAAATAGGGATGGCGAGCATCTTATGATAGTTTATTACG
ATATACTGTTTATGAATGGCCAGTCTTTATTGCAGACTTGTCATGCGGAGCGCTTCCGCCGCTTACAAGAGCTCATCATC
TGTCGGCCGGGTTACGCGGAGCTTGTCTACCGCGAAGTCATCGACTTTGGTAGCCGGGCGGCTGCGGAAAAACTACGGCA
ATCCTTCTCCAGCTGTATCTCGGCGCACCATGAGGGTCTTGTGCTGAAGGCAGAGAGCGATACGTACTTTGACTTCTCGC
CACCAGGATCCGGTCCACTAGAGTGGCCATATATGCGCTGCTACGCCATCAAGCTCAAGAAGGGATATGTCGGGCAGTTC
GGCGAGGTAGGGGACTTTGCCGTCGTTGGAGCCCGATATGATGCTGTCAAGGCCAAAGAGTACCCCTCTGATCTGCCTAG
CTTGCGATGGACACATTTCTACCTAGGATGTCGGAAAGCAGGGCATCGGACAGCACGGGATGCACAAAAAATCGAAAGAT
CACGTCCACAGTTCGTTGTTACCAACGTTGTTACCCTGAACATTCCCCAGATGAGGACATTTTTGACCCATTGCCGCCCA
CGAGTGGTGCCGGTGATTGAAAATGGTGGCGCTGATACGGATGTTGCACCATTTAAACTCGCCCCATTGGATCCCGGCAT
GGATGGGTGCCGAGGCGGCCCTACAGACCTATTCGCCGATCCCCCTGTCGTGGATATTCGTTGCTTCGCATTCCATCGCC
AGGGTTTCGGCCGCTTCTGAAGCCCGCGATTTCCGTCCGTGTCAAAGTTCCACTTTGATCGCACGTATATGGATGTCATC
ACATTCGATGATCTGCAAACTGTGGCCAGGGACGAATCGCTGAGGAAGCCCGAGGTAGAAACGGATGGAGAATTACAGGA
AGACGATCTTATCAGCCATCATGATTTCGCCGAGACTGGTCACGAAAACGGGGAAGAGAGGACCCATTGGGCCACGCAAC
TCAAACACACAGATTCCGGGGGGATAGCTGTCGATGCCGACACAAGCCAGTCATCGGCAGTGGATACGGCGTCGACAACT
AGCGAGGCAGCAAGCCGATTACCCGATCAGATTGCCATTCCCATCGTGTCAGTTGAAGAAAGCAGTCAAAATTCGGCAGC
GACGGACTCAACCACTTTTACGGCAGCGTTCGCAAGGGCTGCATCGGACGAAAGGGAGAGCTCGGAGCAACTATCACTCC
CATTGCTGCCATCATCACCGAAACCGTCGGCCGAGCATCTGCCATCTCCTTCGCCGCTGCTGAATTTGTCGGCGCCGCCT
GCCAAATCATTGGATTTGCCCAGTCAACACCACGGGGTCGTCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62