GenePrediction:GLEAN_3505 Details

Name: GLEAN_3505
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:549064..549944 (+ strand)
Length: 881
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:549064..549196 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_156:549259..549944 (+ strand)
Length: 686
>GLEAN_3505 class=GenePrediction position=GCSC_156:549064..549944 (+ strand)
ATGCAGTGCAGATCGCGCGCCCTTCTTGTCAGCCTGTTGGCCGTGGCTTCAGCATCGCCCTGCAAGCCAAGGCCTGCCTC
CAGCACAAGTGCCAGTGCAACAACAACACCAACGCTGCCGCTTACCGGTACTGGTAGGCATATACTGCCCCCGGCTTCCC
TCTGTCTGGAAACGCAAGCTAATATCCTCTTTTAGGCAGCGAGCTCTCTGCTGCAAACTCCAGCCTGTCATTGCTCAAAA
TCGCCATTGGTCATGGGCTACAGAATTACACCTGTCTCAACAGCTCGGCAGCTGTAAAGGCGCCTGGTGCCCTCGCTGTG
CTCTACGACGTCACCGATCTGTACCCCGGCATGTCGGGCTCAAGCCTCATTGCTGATGTCTTCGACGCCCTCACCACAAC
CCTGATCTGGAATCAGGATATTCCGCTCAACCTCCAGAACTCGGAGGCCGCTAACCCAGGCACACCTGCGGTGCCCAATG
CCATGGCCGAGAGCCTCTACGGCGCCGTTGTTGGCTCGCCATTTCCCAGCCCAGCTGCGGCTCTGAGCCTGCCGACCGTG
TTGCCGGCTTCTATTCCCTTCCTAGGCCATCACTACTTTGACTCGGCCGGCTCGCCCACGTTTGACCTTTCTGCCGCCGG
CTTGCTGGGAAGCATGGCCAAGGCGAGCGATGTGACTGCTCCTTCGACTGCGGAAAAGGGCCCGCTGGGCACCGGTGCCG
TCGACTGGCTGGAGCTGAAGGACAACGGCCGTGGCATCTCCCAGGGCATCTCACAGGTTTTCCGCGTCATGACCGCCGGT
GGCGTTTCCGAAACGTGCAACAAGGTGGATGCTGCTACGGGCAGTGTGCCCTACACTGCCTTTTACTGGTTCTACGGTTA
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62