GenePrediction:GLEAN_3506 Details

Name: GLEAN_3506
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:556690..557151 (+ strand)
Length: 462
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:556690..556863 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_156:556936..557151 (+ strand)
Length: 216
>GLEAN_3506 class=GenePrediction position=GCSC_156:556690..557151 (+ strand)
ATGTTGACATTCGAGCTGCTCGCACGCACCAAAGCGGCAGTCAGCCAAAAGCAGTTCTACAGCAACACCACCTCCATGTC
GAAGCCCATCCAGCGCCTGACGCTCTTCAAGATCGCTGATATGGCGAACCAGAAGAAGCTGCTGGAGTACTACAAAGCTT
TACCGACAAAGGCCGTCAAGGCAGGTCTCTCTCCGATCCACTTCACTTTTCCCTTTCGGGCTGGAAGCTGCAGCTGACTC
TCTCAGGATGGCAAGCCGTACATCAAGTCAATCATGGCCGGGCTCACCAAGGAGGACCAGCGTAACCAGGGCTACACGGT
GGCAGCCAACACGACGTTTGCGTCGATCGAGGACATGGCCTACTACGACAACAATTGTGCCGCGCATGCCGAGGTCAAGG
ATTTTGCCAGACCGGTGACGCAGGACATCCTGATGGTGTATTTCGAGAACGAGATGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62