GenePrediction:GLEAN_3507 Details

Name: GLEAN_3507
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:558313..558940 (+ strand)
Length: 628
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:558313..558547 (+ strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_156:558612..558940 (+ strand)
Length: 329
>GLEAN_3507 class=GenePrediction position=GCSC_156:558313..558940 (+ strand)
ATGAAGCTATCCTATGTCGCCGGTCTCCTGGGCCTCACGGCGTCCATTGATCGGCGTGATGTCGGCGATCTCGCCCAGAG
CCTGCCAGCCTGCTCGCTGAGCTGCTTCCACCAGGCGGCCCAGACCTTTAACTGCGATCCCCATGACATTTCCTGTCGCT
GCTCCAAGGAAGTCCAGATGACAGCCACCATGGAACGCTGTCTGCAGCGATCCTGCTCGGACCACCACAAAGCGAGTGCG
TGACCCTACTGCTGCCGCCTGCTGCTAATCCATCTGCTGACATAAGCACAATTTCTCAGTCACCGAGAATCTCTCCCACG
AGATCTGCAACATCCAGCTGCAGAACAACATGCTGTACAAGAAGTCGGCCGAAGCCGCCCCAGCGCCAGCTCCAGCTCCG
GTTCCGGCAATCCCAGATGTCCCGGTCGTGCCGGATTTTGCTCGTCGGGCGCCTGAGGCTGTGGCGTCGTTCCCGGTCAT
CGCCTCGAGCATCCCGGCATCGTCCATCGCCCCCTTTGCGACCAGCACGGCCACACCGGCGCCCGTCGTGACCGCCGGTG
CCGCCGCAGTTGCCACGCCCGTTGCCATGTTGGCGGTTGCCGCTGCCCTCGGCGCCATTATGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62