GenePrediction:GLEAN_350 Details

Name: GLEAN_350
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1197743..1199493 (+ strand)
Length: 1751
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1197743..1198294 (+ strand)
Length: 552
Type: CDS
Source: GLEAN
Position: GCSC_167:1198363..1198399 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_167:1198459..1199327 (+ strand)
Length: 869
Type: CDS
Source: GLEAN
Position: GCSC_167:1199377..1199493 (+ strand)
Length: 117
>GLEAN_350 class=GenePrediction position=GCSC_167:1197743..1199493 (+ strand)
ATGTCTACGACTCTCCGGTCGGCCGTCAATGGCCGGTCAAGCTCGACGGCTGTCATCATCCCGCGCACGGTGGCCTCGCC
CACGCCGCTCGTCGTCTCCTATCTCGACCTCGTCTCGGACGTGTCTCGCTACCAGGCCAAGCTCGCAGGACTCGGCATTG
GTCTGGCGGCACCGGTATCTATTGCCACGGTCAACTCGTACGAGTTCATCGTTGCCTTTCTCGCTGCTGCCTGGCAGCGT
GCCGTGGCTGCACCGCTCAACCCGGCCTACAAGCAGGACGAGTTTGAGTTCTACATCGAGGACGTCAAGTCGGCCATCGT
GCTCGTCCCCCGAGGCGCCTATGCTGCCGACAGTCCGGCCGTGCGTGCTGCTCGTAAGTTCCATGCCGCCATTGCAGAGT
CGTACTGGGACGAGGCCAGACGTGAGGTCGCCCTCGACGTCAAGGAGCTGGGACAGCTGGAATGCCTGACCGCTCAGCCG
GTCCTAGTGGCCGAGCCCGACGATGTGGCCCTTGTGCTGCATACGAGCGGTACTACTTCTCGGCCCAAAGTGGTTTGTCT
CCCTGGGCCTCGCTTGCTTGCCTAATTTTCCTGGAAATCTTACCTGCTTCTCTCTTCTAGGTGCCTCTCACACATCGCAA
CCTGACACGGACGATGAGTTAGTTGAAGGCCCCCCCCCCATTTTACGTGTCCATCGAGCCTCACTGACAGCGGCAGAGAA
CATCCAGGACACATACCAGCTGACTCCGGCCGACCGTACGATGCTGGTGATGCCTCTATTTCACGTGCACGGGCTGGTGT
GCGGCCTGCTGGCGCCGCTGCGGTCGGGCGGATCACTGATCGTGCCGCCCAAGTTCTCGGCCACCGAGTTCTGGCGCGAC
TTCGTCGAATACGGCGCCAACTGGTATACGGCCGTGCCGACGATCCACCAGATTCTGCTGAAGAACCCGGTGCCGCAGCC
GCGGCCGGCCATCCGGTTTGTGCGGTCGTGCTCGTCGCCGCTGTCGCCAACCGTCTTTGCCCAGCTCGAGGCTGCCCTGG
GTGCGCCCGTGCTCGAGGCCTACGCCATGACCGAGGCTGCCCACCAGATGACGTCCAACCCGCTGCCACCGGCCCAGCGC
AAGCCCGGTGCCGTCGGTATCGGCCAGGGCGTCGAGATGCGCATCCTCGACGATGCCGGCACCGAGCTGCCGTCCGGCGC
CGAGGGCGAGATCTGTGTCCGGGGTGAGAATGTCACTAAGGGCTACCTCAACAATCCGGCCGCCAATGCTACTGCCTACA
CGGCCGACGGCTTCTTCCGCACCGGCGACCAGGGCCGCAAGGACCCAGACGGCTACATTGTCATCACCGGCCGCATCAAG
GAGCTCATCAACAAGGGCGGCGAGAAGATCAGCCCCATTGAGCTCGACAACATCCTCGCCCGCCATCCCGCCATTGCTGA
GGCCGTCTGCTTTGCCATCCCCGACGACCTCTACGGCCAGGACATTGGCGTTGCCGTCGTCCGCAAGGCCGGCGAGCCGC
TGACGGCCGACGAGCTGCGCGCCTGGGTTGCCGACAAGGTGGCCAAGTTCAAGGTGCCCAAGAAGGTAGGCTACTCCTCT
GCTTCCGTATTTCTATTTGCTGCTGCCACCACAGAAGCTCACAAGCCAGATCTACTTTACCGACGTCATGCCCAAGACAG
CCACCGGCAAGATTCAGAGACGGATCGTTGCCGAAACCATGCAGAAGCAGGACGGCAAGGCGAAGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62