GenePrediction:GLEAN_3514 Details

Name: GLEAN_3514
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:598579..600197 (+ strand)
Length: 1619
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:598579..598743 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_156:598811..599052 (+ strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_156:599105..600197 (+ strand)
Length: 1093
>GLEAN_3514 class=GenePrediction position=GCSC_156:598579..600197 (+ strand)
ATGGCAGATGCAATTCCGGATGCATCGCCTACGGCAATTGGCCGTAGGATTGTGACAAAGGTCGATTGGCACCTTGTACC
GACACTTTTCGGCACCTGTCTGTTCTTTTACATGGACAAGGGTATTCTGTCCAGCGCATCCGTTTTTGGCCTGGAGAAGG
ATCTGGTGAGACGGCCTTGGCTGGCAAGAGAGAACCCGTCCTGAGAATTATTGACCTAATGACGGAGAACAGCATCTGGT
CGGCCAGGATTACAGCTGGTCCTCGAGCGTCTACTATTTTGGGTACTTGTTCTGGATGGGGCCGTCTGCTTGGATGTGCT
CGCGGCTGCCCATTGCTAAATACCTGACCCTCAACACGCTCATCTGGGGCCTCATCGTTGGTCTGACTGCCGCTTGCACA
AGCTTTGGCGGCCTGGCAGCCAATCGCTTCTTTTTAGGAGTCGCCGAGGCCGTTGTCAATCCGGCCTTTATGTAGTAGGT
TCTGGCCTTTGACCCCTGCAAAGTCTGATCACTAACACGGCGGCAGCATCACTTCGACCTGGTATACACGCGATCAGGTT
CCCAAGCGCACCAGTCTCTGGTTTACCGGAAATTCGATTGGAGGTCTGGTTGCAGCCCTCTTCGCCTACGGTGTCGGCCA
CATTTCTCATCCTCTACACCCGTGGCGTTGGATGTACATCATTCTTGGCATTCTGACGGCGATCTGGGCAGGGTGCATAT
TCTTCCTACTGCCAGACAGTATCTCAAGGGCAAGGTTCTTGACCGAGGACGAACGACAGTGGGCGGCGGATCGTGTTGTC
CTGGCCGGGACAGGACGCACTGAAAAAGCGCCCTGGCGATGGGAGCAGGCTGTCGAATGTCTGGTCGACCCAAAGACGTG
GTTCATTGTTGCCATCTTGTTTTGTGTCCAGCTTCCGTCTGGCGGCATTCAGAGCTTCGCCAACATTGTCATCAAGTCAT
TCGGCTTCTCCTCCCTTGAATCGACTCTGTTGTCGATCCCATCAGAAGTGATTGCCGCCTTGTCCATTGCTATTACTGGC
TATTTTGCTGGCCGCTATCGCAACCTCCACTGTCTGATGATCATCCTTTCCGTCATCCCTGTCCTTGTCGGCGGAGCCAT
GATTTACAAAAGGAAGCACATCTCCAAAGGCGCTCAGCTTTTCGCGTACTTTCTCATCCAGACAACCTTTGCGCCTGTGC
CACTTCTCATGTCACTAATTCAGACGAACTACAAGGGTGTTACAAAGAAGATGACCATGACGGCAATATTTTACATTGTC
TACTGCGCAGGAAACATTGCCGGTCCCCAGCTATTCAAATCGAAAGAGGCACCTGCCTATCCTACCGCCTTCAAGGCAAT
TATGGCATGCCCAGCTCTCGTTATCGCTCTCTGTATTGCCTTCCGGATCTACTTGCTATCGCTCAACGCCAAGCGTGTTC
GGGTGGAAGGATTGGAAGGCAGCGCAGGTGTTTCAGGGGCTGTTGCGGGAGGCAAGGTCTTTGAGATAGGGCATAAGTCT
TCCGAAACTGACATGGCTCTTCAGCAAATCGAGCTTCAGGCTGAGGACTACGATGATGTCACAGACTGGAAGACGCTCGG
TTTTAGGTATAGATACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62