GenePrediction:GLEAN_3515 Details

Name: GLEAN_3515
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:601149..603124 (+ strand)
Length: 1976
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:601149..601296 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_156:601358..601519 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_156:602298..602359 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_156:602469..602707 (+ strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_156:602806..603124 (+ strand)
Length: 319
>GLEAN_3515 class=GenePrediction position=GCSC_156:601149..603124 (+ strand)
ATGGTTGCCTCAAAGCGTATCCTTAGCGGAGCTCTCGCCACTCAGGCATCTGCCTCAGTTCTGTTTACCGACCTCGTCCA
GCTCCATGGCCGTGCTGATACCGAGATCTCACCGGGAACCCCTTTGTATAACTGTCACGATAACTGCGGTTTGTCCATCG
TGTGGCCTTGTTTGTAGTCCGCAGCTTTAGGGTCTGACAGAACCTACAGGTCAGGCCATTCTTGAGTCTGGCTACGATTC
ATCCGATGCTCTCTGCTCGGACTCCATCTTCCTGACTGACTATGCCAACTGCCTGGCGTGTGCTGGAACTGATAATGAGG
ACATCTGGCAGTATTACGGTAGCTCGCTGACAAGTGCTGCTGCTGAGTGCGGTCTGTCCACCACTCCCCTCTCTGGAACT
CAGGCTATCGTCGGCACCGCTGATCCTGCCGTCTCTGGTGGCGCTGCTACTGCTACTACTACTGCTGTCGCTGCATCGTC
TAGCTCTAGCTCTGTTCCTGCGGTTGCGACATCAACGGGTGCTGTCAACGAGTCTTCAACAGCCGTGGCTACGACCACTG
CGGTGGCAACCACAGCTTCTACTGGTTTCGTAACCTCTTCCGCCGCCGCCACTATATTTTCGAACTTTACCGTTTCCGGT
GCTGCGTCTGGAACCGCACATAGCAGTAGCTTGAGCACTACTGTCCGTCCACCATCCCAAATTTATAAACCTCTACTTGA
ACAGAACAGACAGCTAACATTCAGCATAGTCTTCCTCCCTTTCTGTCGTCACTGCTGGTGCCAACAGTTACCAGGCTAGA
GCCGGTCTGGCTGGAGTTGTCGCCTTGGGCGCTGCATATGCTGCTCTTTACTAGACAGGGGTTCGTTGTACGTCAAGAGG
CGATACTTTAGTCTGAGAAAATGTTACAGAGCTATCAGCTACTATGGATTTTGTCCTAATTATTCAATCGTATAACGTAG
TTCGTGCTTGAAAGACCACAGCTTTGGGCTCTGCTTAGGGGGCATACAGGGTCTATAGCGCTATCTTGCAGGCTGCACTC
GGGATCCACATACGGACAAACAGAATCACATGACCCCGCTACCCAATCTACCAAACCGCCGCCGCGCCACCGCGACACTG
TGAGCGTCATCACCGCGTCTTGGCATCAGGCACGTCGGCAACACCTGTCAAAATGTCGCGGAGAGCTGCTAAGGGAGAGT
ACATTGAGACGGTAGGTTTTCTTGGTTTCTTCGGAGAAGCCAATCCCCGACAGCAGCATTCCAATCAAGAATCTCCACCG
CTGGAACCACATTGCTGATCGGTTGCTAAACTTTTGTTAGGACACAGGAAACAAGGTGTCACGAAGAGCCAATCTCGTCG
GAACGCAGAACATCATTCTCGGCGGAAAGAGTGTCATCCAGCAAGATGTCATGATTCGAGGCGATCTTGTCCGGTCGCTG
CCAGCGTCGAGCAGCAGCGGCTCGTCTTCAAGCTCGTCAAGTACTGCGATATCCATTGGACGATACTGCTTCTTGAGCAA
GGGTGCATGCTTGCGCCCACCGGGTCGACTGTGGAAGGGGTGCGTTTTACATTGAAGAGGAAAAAGAAGAGAGTTGAGCG
AAGGCCTAAAGTACGGCCTGTTTATTCGACAAGGTGCTGATGGTGGCAACATTCCAGAATATTTTCCCACATGCCTCTCC
GCATGGGCGACCATGTCTTTATTGGCCCCGGCGCCACCGTCATGGCGGCTTCCATTGGAAATCACGTCCATATCGGCGAG
AGCACAGTGATTGGCGACTTTGCCATCATCAAAGATTACGTCCGCATCCTCGACGGAACGGTCGTGCCTCCCAACATGGT
CATTGCCAGCTTCAGCATTGTGGCTGGCCAACCGGCCCGGGTGATTGGAGAGTTGCCCGAAGGCGGCCACGAGGCGTTTG
AGCTTCGCGACCTCTACAAGACCGTTGGCAACAACCCCCAGCCAATGCCAATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62