GenePrediction:GLEAN_3516 Details

Name: GLEAN_3516
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:614468..616437 (+ strand)
Length: 1970
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:614468..614742 (+ strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_156:614807..614853 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_156:614919..615726 (+ strand)
Length: 808
Type: CDS
Source: GLEAN
Position: GCSC_156:615792..616437 (+ strand)
Length: 646
>GLEAN_3516 class=GenePrediction position=GCSC_156:614468..616437 (+ strand)
ATGATGCGCTCCACCCGTGCAGCCGCCGCAGAGGAGACATGGGATAAGATGCTCTCGGCCATGGAAACGCCCGCGAGAAC
GATTGCGCCCAAGCGAAGAGGCAGCTTGGCAGACGTCGGCCCGAGCAAGAAGTACAAGAGCATCTCGCCACGGCCAGCCG
CTGATTTTTTTTTCGGGGCTCTGCAGAGGCGGCTGCAGCTGCCGCAAACGAGCAGCTGGACGGGGCCGACTTGTTGCTGG
CCGTATCGAGAGGCCTTGGCCACAAGGCCTCACTTGTGAGCTGCCCGACAATTTCCATCGCATCCGGCAGCTATTGGAGT
GAGCTGTTCTGCTGACCAGTCGTCTGCAGGCATGTGACACATGTCGCCACAAGAAGGTCAAGTGCAGTGAGAGCCGGCCG
GCGTGTGCGTACTGCTCTCGACATGGCTTCCAATGCTCCTATACCGATCAGACTGGGGCATTGTAAGTGGAACAGACCGA
AATCTCGTGGCCACATGGACTGACCAGGCCAGGAGAACCAACGAGAAGGTGGCCGTGCTGCTGGAGCGCGTCGCCCGACT
GGAGCAGTCGCTCGAGTCGCTCCGGGACGAAGTCAGGCTGCGAGACTACACGGCTGCATGCGACGTTTCCGTTCACGATG
CTGCCAGAGCTGTTGCCCGGCTCTACCAGACGCCTCCAGACACTGTGTTGTCAGCCAAGAGCCCGCTCTACAGCCACGGG
CCAGTAGCCATTGAGGCCGTCGAGTCGCCTCTGAGCCTTCCGCCCGATTTTTCCACCACAACTACTACAAACCCCTCCAG
ATTCGCGTCCACGACACCCTTCGCCTGCGAGGAACGACGAGCTCCGTTGCCGAACCTGCTCGCTCTCGAAGCTCCCACAG
ACGCGGACGAGATCATGGCCCATGTCGACAGCTACCTCGGTCAGCCGTACGATCTGTTCCCGCTGATGTGCAAGAGCTCC
GCGTACGCGGTCGCCGTGTCAGTGCGCAAGGACGGCCTGCAGCCCAACCTGCAGTCTTGCTATGCGCTGCTGATGGTCGC
GTTGGCCAAGGCCTATGCCGATCCCGAGTGCGTTGACAGCGGCCTGGCCGACTTCCAGATGGCCGGTCAGATCCGCGGCC
GTCTCGGCGAACAGCTCAACCTCGAGTCCGTCGTCGTCCAGTTCCTCATCACCATCTTCCTGCTCAAGAAGGGCCTGATG
ATCAACTTTGCCCTCGCGCTGCATGCCGCCTGCTCGTCGCTCTATACGCTCATCAAGAGGTGAGACTCTTCCGGGGACCT
GCATTCCCGTTTCTGGTATAGTAGCGGCTCACATGTTTCGATAGGGACCAAGCATCCGGCATCGAGCGCGACAAGAGCGA
CCGCAACACGATATCGTCAAGCTTCTGGATCGGCCACAATCTGGAGAGAGATCTCGTCCGCGAGATCGATGACACCTTTC
CGCAGAGCTCCCTGCATCTGCTGGCCGAAGGCTTCATCCTACCGCTGGGATGCGACGACTCGCCGAGCCCGAGCGCGCCG
CCAATCATCCGCGACGAGATCATGTTCTTCTTCGCCGAGATGGCCCTCCGAGCTGTCACGGCGCGCATCTTGACCACGCC
CTACTGGAAGATTGGCGGCGCCGACCGTCCAGAAGCCGGACCACCAGAAATCTCTCCCCTGCTTCCGGAGCTGCGCGGCC
AGCTGGACGAGTGGCTGCTCCGCATGCCTGCCAGTCTGGACTGGTCCACAGAGCCGGTCAGGGGCTCGAACTCGCCCGTG
GTGGCCCGACTGAAGATCCTCTACTGGTTTGCGCGCTTCTCTTTGGCCCGGCCTCTGATCGTCGAGGCCCTCCGCAATCC
AGCCTTCTCTCTGCCCCTCCAGGGCTGGGTCCTCTTTCAAGACGGCATAATGTCGGCCATGAAGGTGCTCAAGGTTCTTC
TCTGGGAGGAAACCGAACTCGATTTCCTTATGGGCAATAGGTATGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62