GenePrediction:GLEAN_3517 Details

Name: GLEAN_3517
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:618647..620861 (+ strand)
Length: 2215
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:618647..619053 (+ strand)
Length: 407
Type: CDS
Source: GLEAN
Position: GCSC_156:619144..620560 (+ strand)
Length: 1417
Type: CDS
Source: GLEAN
Position: GCSC_156:620841..620861 (+ strand)
Length: 21
>GLEAN_3517 class=GenePrediction position=GCSC_156:618647..620861 (+ strand)
ATGGTGTCGTCCGCCAGCGCGGTCTCGCCGCCGCAACCAGGGAAGCCGTCGTCAGCAGCCAATGATGCAATTTTGCGCAA
TGCGCTGCGATACACCATGTCGGCACGCGAGTATGCGGCGCTGCACAAGTACGTACTGTCACGGTCGCGAATGGTGCGAC
GACACGTGCCCAGCGTCGAGACGGTCGGCCGGATCATGGGCGGACCGCCAGTCAAGAAGAAGAAAAAGGACAAAGAAAAG
GACAAAGAAGAGGCAGAGACATCTTCAGCACCAAAGACGGGCGCTATTGTAGGCGCAGACGACTTCAATACACGGGCAGT
ACGGCACGCGCTGCGTGTGTTTGCGGCCACGGCGAGCGGAATGCGGCTCTTTGGGGCGATCCAGCGGCGATTTCTAGGCG
ACAAAACGTGAGTACTTTCCCGTGCCTCTGAACATGGCTGTATCGTCAGGCCTTGTGTCCTCGGATGTGTTGCTCTTTCG
ATCTGACCTTTCCATAGCTCCAAAAAGAAGCCGCTGCACAAATTGCCCACAGTACGGCTTTCGCTCTCACTCTCGACCAT
CCTGCTGATGTACCGGCTGCTCTTCCGGTTCTTCACACGTCTGCGCACAACACTGCTCGACCCGGCGGCGCTGCCGTTCC
GTTCACGTAACCCGCGCACAGCCGCAGCGCTGACATCGTCCTATGCACCCGCAGCAGGAGCCTCATTGGCGGGCCTGGCG
CTAGGCATTGCTCCGGCTCGGTTCCGGATGATGCTGGCGCTCCTGGCGGTCTTCCGCGGACTGGAGTTTGCCTGGAATGC
GGCAGAAGACACGGGGGCCATCTGGGGCGTCGACATGGTACCCGTGGCAGTGCGGTCTGCCATGGGAGCTGCGGCAGGAG
CACTCGTTGGAGACAACGGCGACTCTGCGATGATCGGGAGCTGCAGCAGCAGCAGCGGAAACGACGGCGTTGTCCTGCGG
GCACGGCCTCGACAGCGGCCATGGTGGTGGGGCTCGTGGATGCTGCAGCCGTTTGCAGTTGGACAAATGCTGTACGCAGC
TGTGTTTGACCGGGACTGCTTCCCGTCGTTGCCGTTAGGAAAGTTTGTCCTGGGACAGATGGAGGCCACAGACACATACC
TGCACACAGCCCCCGTGGACGCATCGGCGTCGGTGGTGGCGGGCTGGCCGGGACCAGCTGCCGTGATGGACGCGTTGGCA
GCAATGGCGCGGGCACAGTGGCCAGCATTTGCATCGCCGATTCTCTTCCCAGGCAAGGAGGCAGAACAGGTGGTCACGCT
GGCAGCATCCTCGCCAGCCGTGGCCGCAGTGATGCCGTCGCTGGTGGCACGGGCACATCCGCTGGTGGCGTCGCTGAGCT
GCGCCACACTGCATCCAGACGACCCGTCATGCGGCCGCACGCAGCTGCTGTTCTGGCTGCGGTCGTTCCCGGCGTATGCG
CGAGCCTTCTTGGTGCTGTACACGGCACTGCAGCTGCCGCGACTGCCACAGCTGGCGGCAGCACTGCACGACGCACCGCT
GCGGGCGATACAGCAGCTGGTGGTGGCACGGGCGCTGCGGTCGGCGACCATGTTGACGGGAGCATTGTCGACAGCCTGGG
CATCATTATGCGTGTTCCAAGCCTGGCTGCCGCGCCGGGTGCTGGCAACACAACGCGTGTATCTGGGCGGCTTCGTGGCC
GGCCTCTGGGCCTGGCTCGAGCGGCGGCACGGCCACGCCGTCTTCCTCTACTCGGCGCGCGCCAGCTTTGAGAGCTTCGT
GCGCATGGGTGTCAAGCGCGGCTGGTGGCGGTCACCTGCGCGCAGCGGCGGCGACGTGGCTGTCTTTGTCGCAGCGCTGC
TTCTGGCCGGCACGGCATATGAGCGCGAGCCACGGGCCCTACGTGAGCCGGCCTGGCGCAAGGGTATCAGTTGGGTGCGC
GGCGAGGGCTGGCGCGATTGGGCAGTGGACGAGGACGACAGCGAGGAGGAGGGTGAGGAGGATGACGAGAAGGAGGAATA
GGGAACGATGGCTGGGAAAAATGATATCCAAGGGTGAAGTGTACGATTTGTATTATTGTTTGTATGAAACGTTGGATTTG
CTTGAAATGAGTTGATTGAGTCCAATGTCTGCAAAATATATCGACGTAAGAGCCAATCTAGCAAGATACAACAAGGTTTC
AAAACAGATATGACAGGTAGTTTCAACAATTCAGAGCCGGGAGCGGGAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62