GenePrediction:GLEAN_3518 Details

Name: GLEAN_3518
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:623860..625027 (+ strand)
Length: 1168
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:623860..624064 (+ strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_156:624150..625027 (+ strand)
Length: 878
>GLEAN_3518 class=GenePrediction position=GCSC_156:623860..625027 (+ strand)
ATGCCGTACCCCGACAAGTTTACCGGCTTCCAGGTCGAGAGCGCTGAGACTTGGCGCGAATTCCACAAGAACGAGTTCCA
GCCAAAGCCGTTTGGCGACTATGATGTCGACATCCAGATTGAGTGCTGCGGTGTCTGCGGTAGCGATCTGCACACCATCA
ACGGCGGCTGGGGCGAGCAGAAGTGGCCCTTGGCAGTTGGTCATGGTGAGTTTTGTGATTTTGTGTTGTCTGTGTTGTCT
GTGTTTTTCTGTTACTGCGTCTTGCTGTCGCCTTCTCACTGACTGCTCAGAGATCGTCGGCAAGGCGATTCGTGTTGGCC
CCAAGGTGACGCTGATCAAGGAGGGCCAGCGTGTGGGCGTGGGCGCGCAGTCGTATTCGTGCCTCGACTGCCGCCAGTGC
AAGAATGACAACGAGACGTACTGCCGACAGCAGCTGGACACGTACGGAGCCACGTGGCCGGACAGCGGTGTGGTGTCGCA
GGGCGGCTACTCATCGCATGTCCGCACGCATGAGCACTGGGTGTTTCCGATCCCGGATGCGCTGCCGTCGACGGCGGCTG
GGCCGATGCTGTGTGCCGGGCTCACGGCCTTTAGTCCGCTTGTCCGTAACGGCTGCGGCCCCGGCAAGAAGGTCGGCATC
GTCGGCATCGGTGGCATCGGGCATTTTGGCATCCTCTTTGCCAAAGCGCTCGGCGCCGAGGTCTGGGCCATCTCGCGGAC
GCACAGCAAAGAGGCCGATGCGCGCAAGATGGGCGCCGACGGCTTCCTCGCCACGGCCGACGCCGACTGGGCAGTGCCAC
ACGCCATGACGTTTGACCTGATCGTCAACTCGGCCAACTCGTTTGACGGCTTCGACCTGGCCGCCTACCTCTCCCTGCTC
GACGTGCACGGCCGATGGGTGAGCGTGGGCCTGCCGGGGGGCGACGGGATCATGGTGCGCAACCAGTCCTTCCTCAGCAA
CGGCTGCTTCTTCGGCAGCAGTCACCTGGGCAGCCGCAAGGAGGCCCTCGCCATGCTCCAGCTCGCCGCCGACAACAACA
TCCGGCCCTGGGTCGAGGAAGTGCCTATCAGCGCTGAGAACCTGTCAGCCACCCTCGACCGCCTGCACAAAGGCGATGTC
AAGTACCGCTTCTGCCTGACCAAGTATGGAGATGTCTTTGGCCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62