GenePrediction:GLEAN_3519 Details

Name: GLEAN_3519
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:626281..627378 (+ strand)
Length: 1098
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:626281..626442 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_156:626872..626954 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_156:627015..627378 (+ strand)
Length: 364
>GLEAN_3519 class=GenePrediction position=GCSC_156:626281..627378 (+ strand)
ATGAGCGCCCCACAGATCAACAAGATCGCGCCGACGAGCCCGTCGCGCCAGAACCCATCCGAGCTGGAGACGAGCATCGC
CGGTGCTCTGTACGATCTCGAGACGAACACGTCCGACCTGCGCGCTGCCCTGCGCCCGCTGCAGTTCGTGTCTGCCCGTG
AGGTGAGATGAGAATGCCTCCTATTTACCGTGACCATGTTGGGAAGCAGCGGGGAGGTTGAGAAGAGGGACAACGAGGAC
GAGGCAATCGGCTGCCATCGGTGGCTAGTTCAGAGACAACATCATAGCATCGTGTTCGAGGACGCAGACGGTCCGACAAT
CTGATTTCTTGCACGGAAAGCGTGATGAGTGACCGACTCGACTGCCTTCTCAGACCGATTCGACGATACTGCCCTCTCGA
CAGCCCAACGTCTTTTTCCTCGACCTCTTCTCTCTCCTCTGCTCTTTCGAAAATCCTGTCGCTTGACGCACCCCCATACA
CACAGAATGTTGTGGATACAGGACGGGAAGCGGTCCATGGATGGTGTTTTGACGTAGAGGAGAACAAACGCATCCAGGAG
CTCGCATGCTGACTTGGGATCTGAATCCTAGATCGAAGTCGGCCACGGCAAGAAGGCTATTGTCATCTTTGTCCCCGTCC
CATCCCTGCAGGGTTTCCACCGTGTCCAGCAGCGGTAAGTTTTTTCTGTCCGCCGCTTTTGTTTGCTTGGGCTCCGTTCT
GACCAGACGACCAGCCTCACCCGCGAGCTGGAGAAGAAGTTCCCTGACCGCCACGTTCTGATCCTGGCCTCGCGCCGCAT
TCTCCCGCGTCCCAAGCGGTCTAGCCGCTCGCGCAACACGCAGACCCAGAAGCGTCCCCGTTCGCGCACCCTGACTGCCG
TGCACGACGCCATCCTGACCGACCTCGTCTACCCGGTCGAGATCGTCGGCAAGCGTCTCCGCACCAAGGAGGACGGCAGC
AAGACGCTCAAGGTCATCCTTGACGAGAAGGAGCGCGGTGGCGTCGACTACCGCCTGGACAGCTACTCTGAGGTCTACCG
GAGACTCACCGGCCGTGCCGTCGTCTTTGAGTTCCCCCAGACCAGCGCCGAGTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62